Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

The YASARA 3DM connection


YASARA 3DM plugin

While Bio-Prodict's 3DM protein superfamily data integration platform can be accessed from a web browser,  many of its advanced functions benefit heavily from the tight integration with YASARA. If you own a 3DM (trial-)license and download YASARA, a 3DM menu will be available (as shown in the image on the right). The connection to 3DM allows you to instantly plot many different kinds of data of a complete protein superfamily directly in a protein structure. Data as diverse as conservation data or correlated mutation data extracted from alignments, mutation data mentioned in the literature or in patents, SNP data available from whole genome sequencing, ligand contact data, protein-protein interaction data, and many others is automatically collected by 3DM for a complete protein family and can directly be visualized in your favorite structure. For instance, by simple keyword searches hotspots are highlighted that in literature are mentioned in combination with the keyword and a link is provided to the corresponding literature. The image shows positions known to cause Hirchsprung desease in the GPCR protein family.

For more information about 3DM, please watch Bio-Prodict's introductory movie and then contact Email.