Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Report inconveniences, problems and bugs

Before reporting a problem, please check your YASARA user manual:

  • If the problem is a general one, visit the Troubleshooting section in the manual.
  • If the problem is specific to a certain command, visit the Commands section and browse to the command you used.

Also note that YASARA is continuously improved, with new features added and problems solved on a weekly basis. If your current YASARA installation is more than a month old, it might therefore be helpful to download an update here. To compensate you for the time spent on the problem, up to 10 Euros will be subtracted from your next bill. This allows even owners of YASARA View to get higher stages for free.

Reports are always welcome, but the following restrictions apply to the bonus credits:

  • You must be the first to report the problem in a reproducible way.
  • The problem must not be the fault of a third party (e.g. the graphics driver).
  • The money you earn can only be used to pay YASARA license fees. We cannot send you any money back.


Please define the problem

Type of the problem:
Detailed description:
Which commands did you use?
What went wrong?
What did you expect?
ZIP file with example data (files larger than 5 MB must be sent by email):
If reproducing the bug requires additional data, upload it above.
If just one file is required, you do not have to ZIP it.
It helps if the address is the same as in your initial YASARA registration.
Click here to change it.