Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

° 

The YASARA Feature List

Below you find a list of all YASARA commands. These commands are accessible from the graphical user interface, but can also be typed directly in the YASARA console or in a YASARA macro created with any text editor.

Blue commands are always present (including the free YASARA View), magenta commands require YASARA Model or above, red commands require YASARA Dynamics or above, yellow commands are only available in YASARA Structure, and green commands additionally require the Twinset.

The full user manual is not available online, click Help > Show user manual in YASARA or open the file yasara/doc/index.html in your browser.

° 

File

-

Load and save the scene or parts of it

° 

New scene - Start again

Clear all objects and bitmaps for a fresh start or reset YASARA entirely, including simulation parameters and undo-history.

° 

Clear

-

Clear scene

° 

Reset

-

Reset YASARA to startup state

° 

PDB files - Load and save objects in PDB, PDBx and (mm)CIF format

Load PDB files and save them again in standard PDB or X-Plor format. The limits of the PDB format (99999 atoms, 62 molecule names) are removed by its successor, the PDBx/mmCIF format, which is supported by the LoadCIF and SaveCIF commands.

° 

LoadCIF

-

Load CIF or mmCIF file

° 

LoadPDB

-

Load Protein Data Bank file

° 

SaveCIF

-

Save CIF or mmCIF file

° 

SavePDB

-

Save Protein Data Bank file

° 

YASARA objects - Load and save complete objects

Load single objects in YASARA's own format, including styles and items and save them to disk.

° 

LoadYOb

-

Load YASARA object

° 

SaveYOb

-

Save YASARA object

° 

YASARA scenes - Load and save the entire scene

Load all objects together and save them including styles,items and the view.

° 

LoadSce

-

Load complete scene

° 

SaveSce

-

Save complete scene

° 

Sequences

-

Load and save sequence files

Save parts of the soup as a sequence in FASTA format, or build proteins and nucleic acids from FASTA files.

° 

SaveSeq<Res|Mol|Obj>

-

Save residue sequence

° 

OpenBabel

-

Import and export molecules using OpenBabel

When working with more exotic file formats, import and export structures with OpenBabel.

° 

Load*

-

Import file with OpenBabel

° 

Save*

-

Export file with OpenBabel

° 

Screenshots

-

Save plain or ray-traced screenshots and Wavefront objects

Save simple screenshots compressed or uncompressed (optionally including the menu), save scene descriptions for POVRay or run it immediately to create photorealistic images including shadows. Polygon meshes can also be exported in Alias/Wavefront Obj format for use by 3D graphics packages like 3D Studio Max.

° 

RayTrace

-

Create raytraced screenshot using POVRay

° 

SaveBmp

-

Save screenshot as uncompressed Windows bitmap

° 

SavePNG

-

Save screenshot as compressed PNG bitmap

° 

SavePOV

-

Save POVRay scene description

° 

SaveWOb

-

Save Alias/Wavefront object

° 

MPEG movies - Encode plain or ray-traced animations

Save MPEG movies (optionally including the menu).

° 

SaveMPG

-

Save MPEG video

° 

Simulation snapshots - Load and save simulation states

Load simulation snapshots to restore atom positions and velocities at a certain time or save them in periodic time intervals. Atom positions without velocities can also be saved and restored in XTC format, which minimizes the required storage space. Alternatively, AMBER's easily parsable MDCrd trajectory format can also be read and written. Atom types and point charges can be saved as AMBER Prep topologies, they are however ignored when Prep topologies are loaded.

° 

LoadMDCrd<Obj|All>

-

Load simulation snapshot in MDCrd format

° 

LoadPrep

-

Load AMBER Prep topology

° 

LoadSim

-

Load simulation snapshot in sim format

° 

LoadXTC<Obj|All>

-

Load simulation snapshot in XTC format

° 

SaveMDCrd

-

Save simulation snapshots in MDCrd format

° 

SavePrep<Res|Mol|Obj|All>

-

Save AMBER Prep topology

° 

SaveSim

-

Save simulation snapshots in sim format

° 

SaveXTC

-

Save simulation snapshots in XTC format

° 

Maps

-

Load and save electrostatic potential maps

Save the electrostatic potential as a 3D map in Delpha format and load it again later.

° 

LoadESP

-

Load and visualize electrostatic potential

° 

SaveESP

-

Save electrostatic potential map

° 

Exit

-

Quit YASARA

Exit YASARA immediately.

° 

Exit

-

Exit YASARA

° 

Edit

-

Change content and properties of the soup

° 

History

-

Undo and redo changes

Undo and redo a number of changes up to the maximum undo-level.

° 

Redo

-

Redo changes

° 

Undo

-

Undo changes

° 

UndoLevels

-

Set number of undo levels

° 

Selections

-

Permanently tag atoms as selected

Interactively select atoms within a rectangular box, an arbitrary area or a sphere. The atoms can alternatively be chosen using YASARA's selection language and unselected later.

° 

SelectArea<Atom|Res|Mol|Obj>

-

Interactively select atoms within an arbitrary area

° 

SelectBox<Atom|Res|Mol|Obj>

-

Interactively select atoms within a rectangular box

° 

SelectSphere<Atom|Res|Mol|Obj>

-

Interactively select atoms within a sphere around other atoms

° 

Select<Atom|Res|Mol|Obj|All>

-

Select atoms

° 

Unselect<Atom|Res|Mol|Obj|All>

-

Unselect atoms

° 

Groups

-

Collect atoms in groups to simplify selections

Atoms can be added to and removed from up to 16 different groups, which simplifies selections. Newly created groups can be found in the right-most list in selection windows.

° 

Group<Atom|Res|Mol|Obj|All>

-

Add atoms to group

° 

Ungroup<Atom|Res|Mol|Obj|All>

-

Remove atoms from group

° 

Objects

-

Center, transform, transfer, remove, add and delete

Center objects for more intuitive mouse rotations, transfer them on top of another object, transform the atom coordinates, remove them temporarily from the soup (e.g. to exclude them from simulations), bring them back and delete them partly or entirely.

° 

Add<Obj|All>

-

Add objects to the soup

° 

Center<Atom|Res|Mol|Obj|All>

-

Center atoms or polygon meshes

° 

Del<Atom|Res|Mol|Obj|All>

-

Delete atoms

° 

Remove<Obj|All>

-

Remove objects from the soup

° 

Transfer<Obj|All>

-

Transfer objects into another coordinate system

° 

Transform<Obj|All>

-

Transform objects

° 

Split points - Edit split points, split and join entire objects

Split points correspond to 'TER' entries in PDB files. Add or delete them, or split entire objects into multiple child objects, joining them again later.

° 

JoinObj

-

Join objects to one final object

° 

Join<Atom|Res|Mol>

-

Delete split points

° 

Split<Obj|All>

-

Split objects at split points

° 

Split<Atom|Res|Mol>

-

Introduce split points

° 

Bonds

-

Add, type and delete bonds

Add bonds between certain atoms, change the order of existing bonds, find bonds automatically, assign the bond orders automatically, change bond orders to the Kekule or resonance form, and delete them again.

° 

AddBond

-

Add covalent bonds

° 

ColorBonds

-

Color bonds

° 

DelBond

-

Delete covalent bonds

° 

KekulizeBond

-

Remove fractional bond orders

° 

Link<Atom|Res|Mol|Obj|All>

-

Find bonds automatically

° 

ResonateBond

-

Introduce fractional bond orders

° 

SwapBond

-

Swap order of covalent bonds

° 

TypeBond

-

Assign bond orders automatically

° 

Building

-

Build atoms to molecules, oligomers, crystals and loops

Swap chemical elements, residue side-chains and entire objects. Create individual atoms, or residues, build loops, SMILES strings, missing residues or entire proteins and nucleic acids, extending them at the C-terminus, possibly adding missing oxygens and protection caps. To prepare a molecular dynamics simulation, clean the structures. Replace residues to transfer loops or fuse proteins and nucleic acids. When looking at oligomers, duplicate objects, use the BIOMT transformations in the PDB file to create the biological oligomeric state or add the crystal symmetry related copies.

° 

AddCap<Obj|All>

-

Add N/C-terminal capping groups

° 

AddRes

-

Add terminal residue

° 

AddTer<Obj|All>

-

Add C-terminal oxygens

° 

BuildAtom

-

Build single atom

° 

BuildGrid

-

Build a grid of atoms

° 

BuildLoop

-

Build central or terminal loop

° 

BuildMol

-

Build peptide or nucleic acid chain

° 

BuildRes

-

Build single residue

° 

BuildSMILES

-

Build molecule from SMILES string

° 

BuildSymRes

-

Build symmetry related residues

° 

Clean<Obj|All>

-

Clean objects for molecular dynamics simulation

° 

Crystallize<Obj|All>

-

Crystallize objects to fill the unit cell

° 

Duplicate<Obj|All>

-

Duplicate objects

° 

Oligomerize<Obj|All>

-

Oligomerize objects to generate the biologically active form

° 

ReplaceRes

-

Replace residues

° 

SwapAtom

-

Swap chemical element of atoms

° 

SwapObj

-

Swap two objects in the list

° 

SwapRes

-

Swap residue side-chains

° 

Geometry manipulation - Set positions, distances, angles and dihedrals

Set or swap atom positions, move or rotate atoms. The quickest way of setting distances, angles and dihedrals is to mark up to four atoms with the mouse and click on Geometry in the atom context menu. It is always the last atom (marked with red fireflies) that moves. It is also possible to generate realistic 3D coordinates from nonsense, 1D or 2D geometry, as well as convert 3D coordinates back to a 2D structural formula. In the Twinset, you can also regularize the covalent geometry.

° 

Angle

-

Set/get angle between atoms

° 

Deflate<Atom|Res|Mol|Obj|All>

-

Convert 3D to 2D coordinates, creating a flat structural formula

° 

Dihedral

-

Set/get dihedral angle between atoms

° 

Distance

-

Set/get distance between atoms

° 

Inflate<Atom|Res|Mol|Obj|All>

-

Generate 3D coordinates for flat or distorted molecules

° 

Pos<Atom|Res|Mol>

-

Set/get atom positions

° 

Regularize<Obj|All>

-

Regularize covalent geometry

° 

SwapPosAtom

-

Swap atom positions

° 

Geometry optimization - Optimize small molecules, side-chains and loops

The geometry of small molecules up to 120 atoms can be optimized using semi-empirical quantum chemistry, side-chains can be optimized using a rotamer library and dead-end elimination, and loops can be tuned considering known conformations from the PDB and force field energies.

° 

OptimizeLoop

-

Optimize central or terminal loop

° 

Optimize<Res|Mol|Obj|All>

-

Optimize molecular geometry

° 

Sampling

-

Search conformational space

Possible side-chain rotamers or domain movements can be analyzed by sampling dihedral angles (internal coordinates), while protein flexibility is best looked at in cartesian space by sampling loops or using Bert de Groot's CONCOORD plugin (currently Linux only). Apply CONCOORD only to energy-minimized structures without bumps, otherwise you may run into convergence problems.

° 

SampleDih

-

Sample dihedral angles

° 

SampleLoop

-

Sample central or terminal loop

° 

Surface environments - Define the context of surface analysis

To show or calculate partial surfaces, add or remove atoms to/from the surface environment.

° 

AddEnv<Atom|Res|Mol|Obj|All>

-

Add to environment for surface calculations

° 

RemoveEnv<Atom|Res|Mol|Obj|All>

-

Remove from environment for surface calculations

° 

Hydrogens

-

Add, swap, delete and optimize hydrogen bonding networks

Add missing hydrogens at default positions, change their order within the residue and delete them when needed. In YASARA Structure or the Twinset, you can also optimize the hydrogen bonding network.

° 

AddHyd<Atom|Res|Mol|Obj|All>

-

Add missing hydrogens

° 

DelHyd<Obj|All>

-

Delete all hydrogens

° 

OptHyd<Obj|All>

-

Optimize hydrogen bonding network

° 

SwapHyd<Obj|All>

-

Swap hydrogen ordering in residues

° 

Water

-

Delete all waters

Quickly delete all water molecules in an object.

° 

DelWater<Obj|All>

-

Delete all water molecules

° 

Names and numbers - Set or get properties of atoms to objects

Change or retrieve names of atoms, residues, molecules, segments and objects, convert a protein sequence from 1- to 3-letter code, assign compound names to molecules, reorder objects or atoms in the soup and change the residue numbers (including insertion codes). You can also change the Occupancy and B-factor of individual atoms.

° 

BFactor<Atom|Res|Mol|Obj|All>

-

Set/get the B-factor

° 

CompoundMol

-

Set/get compound names of molecules

° 

Name3

-

Convert residue names from 1- to 3-letter code

° 

Name<Atom|Res|Seg|Mol|Obj>

-

Set/get names of objects, segments, molecules, residues and atoms

° 

Occup<Atom|Res|Mol|Obj|All>

-

Set/get the occupancy

° 

Prop<Atom|Res|Mol|Obj|All>

-

Set/get the property value

° 

Renumber<Obj|All>

-

Renumber objects

° 

RenumberRes

-

Renumber residues

° 

RenumberAtom

-

Renumber atoms

° 

Seg<Atom|Res|Mol|Obj|All>

-

Set/get the segment name

° 

Simulation

-

Simulate the soup

° 

Preparing a simulation - Define and fill the cell

First define a simulation cell with true walls or periodic boundaries, then fill it with objects and water. A more sophisticated way of filling the cell includes pKa prediction, counter ion placement and a simulation of the solvent to arrive at the right density. For instructive purposes, you can create multiple simulation cells and show the neighbor search grid.

° 

Boundary

-

Set/get cell boundary

° 

Cell

-

Set/get simulation cell dimensions

° 

FillCellObj

-

Fill simulation cell with object

° 

FillCellWater

-

Fill simulation cell with water

° 

ShowCell

-

Create a simulation cell object to visualize neighboring cells

° 

ShowGrid

-

Show simulation neighbor search grid

° 

Force fields - Get the recipe

Choose the force field and the force cutoff for non-bonded interactions, calculate electrostatic forces without a cutoff using PME for accurate results. In special cases, you may want to scale or exclude some force field components. The force field and AM1BCC atom types can also be retrieved to visualize YASARA's assignments.

° 

Cutoff

-

Set force cutoff distance

° 

ForceField

-

Set/get force field

° 

Interactions

-

Set force field terms

° 

Longrange

-

Set long range interactions

° 

ScaleForce

-

Set/get force scaling factors

° 

SimSpeed

-

Set simulation speed

° 

TypeAtom

-

Get the atom type

° 

Simulation parameters - Choose your favorite ingredients

Switch between normal molecular dynamics at a given temperature, simulated annealing with a certain cooling level and energy minimization with a maximum step size. Control the pressure in the cell, set the simulation time, the timestep and the number of screen updates per simulation step. Slow down atoms that move too fast during NMR structure determination and similar simulations.

° 

AnnealSteps

-

Set simulated annealing steps

° 

Brake

-

Simulation brake

° 

MinStep

-

Set energy minimization step

° 

PressureCtrl

-

Set pressure control

° 

SimSteps

-

Set/get number of simulation steps per screen and pairlist update

° 

Temp

-

Set/get simulation temperature

° 

TempCtrl

-

Set temperature control

° 

Time

-

Set/get simulation time

° 

TimeStep

-

Set simulation timestep

° 

Constraints

-

Remove translational and vibrational degrees of freedom

Fix atoms to prevent them from moving, and free them again later. Constraining bond lengths and bond angles permits larger timesteps and thus enables faster simulations. These temporarily frozen degrees of freedom can be brought back to life, exhibiting bond and bond angle vibrations during the simulation. The resulting degrees of freedom can be calculated.

° 

DegFreedom

-

Get degrees of freedom

° 

FixBond

-

Constrain bond length during simulation

° 

FixAngle

-

Constrain bond angle during simulation

° 

FixHydAngle

-

Constrain critical hydrogen bond angles during simulation

° 

Fix<Atom|Res|Mol|Obj|All>

-

Fix atoms during simulation

° 

FreeBond

-

Remove bond length constraint during simulation

° 

FreeAngle

-

Free bond angle during simulation

° 

Free<Atom|Res|Mol|Obj|All>

-

Free atoms during simulation

° 

Restraints

-

Enforce positions, distances, angles and dihedrals

First, it is possible to restrain atoms to their initial positions or enforce certain distances, angles and dihedrals by adding bond, angle and dihedral terms to the current force field. Second, if the NMR module is available, you can determine NMR structures using the same functions as XPLOR to restrain distances and dihedral angles individually or all together via a restraint file. The violation energies and statistics can be obtained using various potential functions and parameters like distance averaging. The restraints can be listed, selectively shown (satisfied restraints in green, violated ones in red), styled, hidden or deleted. Floating assignments can also be analyzed.

° 

AddAngle

-

Add angle to force field

° 

AddDihedral

-

Add dihedral to force field

° 

AddSpring

-

Add bond or position restraint to force field

° 

DelRest<Atom|Res|Mol|Obj|All>

-

Delete restraints

° 

HideRest<Atom|Res|Mol|Obj|All>

-

Hide restraints

° 

LoadTbl

-

Load distance, dihedral and rdc restraints in XPLOR format

° 

ListFloat<Obj|All>

-

List floating assignments

° 

ListRest<Atom|Res|Mol|Obj|All>

-

List restraints and energies

° 

RestEnergy<Obj|All>

-

Calculate restraint energies

° 

RestViol<Obj|All>

-

Get restraint violation statistics

° 

RestrainDis

-

Restrain distance

° 

RestrainDih

-

Restrain dihedral angle

° 

RestrainPar

-

Set/get restraining parameters

° 

RestrainPot

-

Set/get restraining potential functions

° 

SaveTbl

-

Save XPLOR distance and dihedral angle restraints

° 

ScaleRest<Atom|Res|Mol|Obj|All>

-

Scale restraints

° 

ShowRest<Atom|Res|Mol|Obj|All>

-

Show restraints

° 

Running a simulation - Keep the soup from boiling

When everything is ready, start the simulation. Note the possibility to save and restore simulation snapshots in the File menu. When running a non-realistic simulation (like high temperature NMR structure generation or some modeling tasks), you can correct cis-peptide bonds and wrong isomers on the fly, reporting these errors when needed. Knots can be disentangled, and MD simulations can be steered by modifying forces, accelerations and velocities. A translational motion of the solute can be removed to keep it from crossing periodic boundaries.

° 

Accel<Atom|Res|Mol|Obj|All>

-

Set/get acceleration of atoms

° 

CorrectCis

-

Correct cis-peptide bonds during a simulation

° 

CorrectConv

-

Correct naming conventions during a simulation

° 

CorrectDrift

-

Correct solute drift during a simulation

° 

CorrectIso

-

Correct wrong isomers during a simulation

° 

CorrectKnots

-

Correct knots and other entanglements during a simulation

° 

Force<Atom|Res|Mol|Obj|All>

-

Set/get force on atoms

° 

Sim

-

Set/get simulation state

° 

Speed<Atom|Res|Mol|Obj|All>

-

Set/get speed and velocity of atoms

° 

WarnIsError

-

Treat warnings as errors

° 

Analyze

-

Analyze the soup

° 

Atom position - Calculate average positions, RMSFs, RDFs and DCCMs

Get or set the position of selected atoms, sum up positions to calculate averages and root mean square fluctuations, sort distances into bins to calculate the radial distribution function, or add atomic displacements to calculate the dynamic cross-correlation matrix.

° 

AddDisp<Atom|Res|Mol>

-

Sum atom displacements to calculate cross-correlation coefficients

° 

AddPos<Atom|Res|Mol>

-

Sum atom positions to calculate average and standard deviation

° 

AveragePos<Atom|Res|Mol>

-

Average atom positions

° 

BinDistance

-

Sort distances into bins to calculate the radial distribution function

° 

DCCM

-

Calculate dynamic cross-correlation matrix

° 

RDF

-

Calculate radial distribution function

° 

RMSF<Atom|Res|Mol>

-

Calculate root mean square fluctuations and B-factors

° 

Superposition

-

Superpose atoms and calculate RMSDs

Superpose objects based on a selected set of atoms individually, possibly ordered or all together and calculate the resulting RMSDs or CASP global distance test. The actual coordinate transformation can also be accessed.

° 

GDT<Atom|Res|Mol|Obj>

-

Calculate global distance test

° 

RMSD<Atom|Res|Mol|Obj>

-

Calculate RMSDs

° 

SupMulti<Atom|Res|Mol|Obj>

-

Superpose multiple objects

° 

SupOrdered<Atom|Res|Mol>

-

Superpose objects on ordered units

° 

Sup<Atom|Res|Mol|Obj>

-

Superpose objects

° 

Transformation

-

Get previously applied transformations

° 

Alignment

-

Structurally align proteins and small molecules

Protein structures can be aligned automatically in pairs or all together based on either their structure or sequence with certain parameters. A separate approach is available to align small molecules. The actual coordinate transformation can also be accessed. Alignments can be saved in various formats. Similar sequences can be retrieved from the PDB, SwissProt and UniRef90 with a built-in BLAST. Similar structures in the PDB can be located thanks to an all-against-all comparison carried out at the RCSB. Proteins can be twisted to maximize the number of structurally aligned residues.

° 

AlignMulti<Obj|All>

-

Align multiple objects

° 

AlignPar

-

Set/get alignment parameters

° 

AlignPDBMol

-

Align similar proteins from the PDB

° 

AlignAtom

-

Align atoms

° 

Align<Mol|Obj>

-

Align objects and molecules

° 

BLAST<Res|Mol|Obj|All>

-

Blast protein sequence

° 

SaveAli

-

Save alignment between objects

° 

Twist<Mol|Obj>

-

Twist objects to improve structural alignment

° 

Energies

-

Calculate various energies

Analyze the potential energy including individual terms, kinetic energies, binding energies, solvation energies (with adjustable parameters) or formation energies (i.e. heats of formation).

° 

BindEnergyObj

-

Calculate binding energies

° 

Energy<Atom|Res|Mol|Obj|All>

-

Calculate force field energies

° 

FormEnergy<Atom|Res|Mol|Obj|All>

-

Calculate formation energies

° 

KinEnergy<Atom|Res|Mol|Obj|All>

-

Calculate kinetic energy

° 

SolvEnergy<Atom|Res|Mol|Obj|All>

-

Calculate solvation energy

° 

SolvPar

-

Set/get solvation parameters

° 

Electrostatics

-

Calculate charges, dipole moments and potentials

Sum up the charges in a selection of atoms or calculate the resulting dipole moment. In combination with surface analysis, calculate the electrostatic surface potential. The electrostatic potential in the cell can also be saved.

° 

Charge<Atom|Res|Mol|Obj|All>

-

Set/get the summed up charge

° 

Dipole<Atom|Res|Mol|Obj>

-

Calculate electric dipole moments

° 

SurfESP<Atom|Res|Mol|Obj|All>

-

Calculate electrostatic surface potentials

° 

Geometry analysis - Measure distances, angles, dihedrals and show KBPs

For quick measurements, click on an atom, then hold down <Ctrl> and click on up to three more atoms. When analyzing a molecular dynamics simulation, distances (also from surfaces), angles, dihedrals and radii can also be measured from within a macro. The same holds for distances between geometric centers, angles between regression lines and dihedrals between planes fit to groups of atoms. Lines and planes can also be fit to groups of atoms directly, calculating the angles between the vectors if needed. Of course the geometric centers or centers of mass can also be calculated. The preferred distances and dihedrals can be shown as a knowledge-based potentials. The current degrees of freedom in the simulation cell can also be calculated.

° 

Angle

-

Set/get angle between atoms

° 

AngleVec

-

Get angle between two vectors

° 

Dihedral

-

Set/get dihedral angle between atoms

° 

Distance

-

Set/get distance between atoms

° 

GroupAngle

-

Calculate angle between two atom groups

° 

GroupBox

-

Calculate bounding box around atom group

° 

GroupCenter

-

Calculate geometric center or center of mass

° 

GroupDihedral

-

Calculate dihedral angle between two atom groups

° 

GroupDistance

-

Calculate distance between two atom groups

° 

GroupLine

-

Calculate optimal line through atom group

° 

GroupPlane

-

Calculate optimal plane through atom group

° 

Radius<Atom|Res|Mol|Obj|All>

-

Calculate the radius

° 

ShowKBP

-

Show knowledge-based potential

° 

Rotamers

-

Show rotamer distributions

Show the backbone-dependent rotamer distribution for selected residues, or put it directly in the soup.

° 

ShowRota<Res|Mol|Obj|All>

-

Show side-chain rotamers

° 

Scene content - List, count and compare units, get sequences and bounds

List the properties of atoms to objects, including names, numbers and secondary structure, list bonds, list ordered groups of atoms matching SMILES or SMARTS strings, count how many units or covalent bonds are contained in a selection, find differences between selected atoms, residues or bonds, extract the sequence, determine the first and last atom or object spanning a selection and sum up atom masses.

° 

CompareBond

-

Compare bonds

° 

Compare<Atom|Res>

-

Compare atoms and residues

° 

CountBond

-

Count bonds

° 

Count<Atom|Res|Mol|Obj>

-

Count selected units

° 

ElementAtom

-

Get chemical element

° 

ListBond

-

List bonds

° 

ListSMARTS

-

List atoms matching SMARTS string

° 

ListSMILES

-

List atoms matching SMILES string

° 

List<Atom|Res|Mol|Obj>

-

List selection

° 

Mass<Atom|Res|Mol|Obj|All>

-

Calculate mass

° 

Sequence<Res|Mol|Obj|All>

-

Get residue sequence

° 

Span<Atom|Res|Obj>

-

Determine first and last unit spanning a selection

° 

Contact analysis - List contacts, interactions and hydrogen bonds

Search for general contacts, specific interactions and hydrogen bonds between two selections.

° 

ListCon<Atom|Res|Mol|Obj>

-

List contacts

° 

ListHBo<Atom|Res|Mol|Obj>

-

List hydrogen bonds

° 

ListInt<Atom|Res|Mol|Obj>

-

List interactions

° 

Secondary structure analysis - Assign and predict secondary structure

List the assigned secondary structure per residue and the overall secondary structure content or predict secondary structure using the DSC method.

° 

PredSecStr<Res|Mol|Obj|All>

-

Predict secondary structure

° 

SecStr<Res|Mol|Obj|All>

-

Set/get secondary structure

° 

Surface analysis - Calculate surface areas, distances and potentials

Calculations of surface areas and electrostatic surface potentials are influenced by the current surface environment and the resolution of the surface grid. If a protein has cavities, they can be treated separately.

° 

FirstSurf<Atom|Res>

-

Get first atom or residue facing each surface and the surface area

° 

SurfPar

-

Set/get surface parameters

° 

SurfDis<Atom|Res|Mol|Obj>

-

Calculate distance from surface

° 

SurfESP<Atom|Res|Mol|Obj|All>

-

Calculate electrostatic surface potentials

° 

Surf<Atom|Res|Mol|Obj|All>

-

Calculate surface areas

° 

Cavity analysis - Find empty space inside macromolecules

Locate cavities inside macromolecules and get the first atom or residue facing them and their volume, which can also be calculated separately.

° 

CaviVol<Atom|Res|Mol|Obj|All>

-

Calculate cavity volumes

° 

FirstCavi<Atom|Res>

-

Get first atom or residue facing each cavity and the cavity volume

° 

Volumes

-

Calculate VdW, molecular and solvent accessible volumes

Calculations of volumes are influenced by the resolution of the surface grid.

° 

Volume<Atom|Res|Mol|Obj|All>

-

Calculate volumes

° 

Checks

-

Search for errors

Check objects for cis-peptide bonds, wrong isomers and deviations from naming conventions. In YASARA Dynamics, you can additionally check for incorrectly placed water molecules and unsual force field energies and calculate the current solvent density. In YASARA Structure 1D and 3D packing interactions can also be checked. In the Twinset, WHAT IF contributes 22 additional checks.

° 

Check<Atom|Res|Obj|All>

-

Check structure quality

° 

SolvDensity

-

Get solvent density in simulation cell

° 

View

-

Change the appearance of the soup

° 

Alternative views - Handle different views of the scene

To visualize your structures in different ways at the same time, first duplicate a view, then change the view independently using commands from the View and Effects menus, switch between the views, and finally delete views you no longer need.

° 

DelView

-

Delete view

° 

DuplicateView

-

Duplicate view

° 

ShowView

-

Show view

° 

Colors

-

Add a fourth dimension to your figures

In addition to coloring atoms and shifting atom colors, you can also change the background color gradient and the default colors for chemical elements, secondary structure, B-factors etc. . Other commands to color covalent bonds, hydrogen bonds, surfaces and the fog are listed in the section they belong to.

° 

ColorBG

-

Color background

° 

ColorMesh

-

Color polygon mesh

° 

ColorPar

-

Set default color parameters

° 

Color<Atom|Res|Mol|Obj|All>

-

Set/get atom colors

° 

ShiftColor<Atom|Res|Mol|Obj|All>

-

Shift atom colors

° 

Visibility

-

Show and hide, switch on and off

Show and hide atoms, switch entire objects on and off. Look in the essentials section for details.

° 

Hide<Atom|Res|Mol|Obj|All>

-

Hide atoms

° 

Show<Atom|Res|Mol|Obj|All>

-

Show atoms

° 

Switch<Obj|All>

-

Switch objects on/off

° 

Style

-

Display atoms as balls, balls&sticks, sticks and traces

Display atoms as space filling balls (CPK), balls of a certain radius connected with sticks or just plain sticks of a given radius. Show and hide a trace through a selection of atoms (e.g. Calpha atoms). When showing a trace, it may help to additionally hide atoms that are not traced. Styles can be copied between objects.

° 

BallStickRadius

-

Set ball and stick radii in balls&sticks

° 

BallStick<Atom|Res|Mol|Obj|All>

-

Style atoms as balls&sticks

° 

Ball<Atom|Res|Mol|Obj|All>

-

Style atoms as balls

° 

CopyStyleObj

-

Copy visualization style between objects

° 

HideTrace

-

Hide trace through atoms

° 

ShowTrace

-

Show trace through atoms

° 

StickRadius

-

Set stick radius

° 

Stick<Atom|Res|Mol|Obj|All>

-

Style atoms as sticks

° 

Style

-

Set general display style

° 

Secondary structure visualization - Show tubes, ribbons and cartoons

Indicate the secondary structure by showing a plain tube, ribbons, and cartoons with cylindric helices. Change the radius, width and height of the secondary structure elements and hide them again later. It is also possible to override YASARA's secondary structure assignment.

° 

HideSecStr<Res|Mol|Obj|All>

-

Hide secondary structure

° 

SecStrPar

-

Set secondary structure display parameters

° 

ShowSecStr<Res|Mol|Obj|All>

-

Show secondary structure

° 

Surface visualization - Show VdW, molecular and accessible surfaces

Show or hide three kinds of surfaces at various resolutions, color them afterwards or extract fragments by defining a surface environment.

° 

ColorSurf<Obj|All>

-

Color surface

° 

HideSurf<Atom|Res|Mol|Obj|All>

-

Hide surface

° 

ShowSurf<Atom|Res|Mol|Obj|All>

-

Show surface

° 

SurfPar

-

Set/get surface parameters

° 

Cavity visualization - Show empty space inside macromolecules

Visualize cavities faced by selected atoms.

° 

ShowCavi<Atom|Res|Mol|Obj|All>

-

Show cavities

° 

Contact visualization - Show contacts, interactions and hydrogen bonds

Visualize contacts in general or specific interactions, show or hide all hydrogen bonds made by selected atoms and choose their color and transparency level.

° 

ColorHBo

-

Color hydrogen bonds

° 

HideHBo<Atom|Res|Mol|Obj|All>

-

Hide hydrogen bonds

° 

ShowCon<Atom|Res|Mol|Obj>

-

Show contacts

° 

ShowHBo<Atom|Res|Mol|Obj|All>

-

Show hydrogen bonds

° 

ShowInt<Atom|Res|Mol|Obj>

-

Show interactions

° 

Ions and electrostatic potentials - Show ion binding sites and ESPs

Use valence scanning to predict and show ion binding sites or display the electrostatic potential inside the cell.

° 

ShowESP

-

Show electrostatic potential

° 

ShowIonSites<Obj|All>

-

Show ion binding sites

° 

Atoms

-

Choose atom styles

Set the overall atom size, attach various textures to the atoms, and toggle the display of the chemical element symbol or a whobbling plasma inside those atoms that are cut open by the viewplane.

° 

AtomPlasma

-

Switch plasma inside atoms on/off

° 

AtomSize

-

Set size of atoms

° 

AtomSymbol

-

Switch element symbol inside atoms on/off

° 

AtomTexture

-

Set texture style of atoms

° 

Cut-planes

-

Look inside

Create cut-plane objects to look into other objects.

° 

Cut<Obj|All>

-

Cut objects open

° 

Projection

-

Switch the perspective

Switch between perspective and parallel projection.

° 

Projection

-

Set perspective or parallel projection

° 

Lighting

-

Light the scene

Configure the lightsource including shadows and ambient influence, and add fog of a certain color to the scene.

° 

ColorFog

-

Color fog

° 

Fog

-

Set fog density

° 

LightSource

-

Configure the light source

° 

Effects

-

Change and animate the scene

° 

Position

-

Place and move objects, detect collisions

Choose object positions on an absolute or relative scale (including polygon meshes), grab either one, the next or the previous object for movement with mouse and 3DConnexion controller, or let them move automatically in a certain direction or to a certain position. Collisions between objects can also be detected.

° 

AutoPosOri<Obj|All>

-

Position and orient objects or scene automatically in a given number of steps

° 

AutoPos<Obj|All>

-

Position objects or scene automatically in a given number of steps

° 

AutoMove<Obj|All>

-

Move objects or scene automatically

° 

GrabNext

-

Grab next object for mouse movement

° 

GrabPrev

-

Grab previous object for mouse movement

° 

Grab<Obj|All>

-

Grab object or scene for mouse movement

° 

IntersectObj

-

Perform collision detection to find intersecting objects

° 

MoveMesh

-

Move polygon mesh

° 

Move<Atom|Res|Mol|Obj|All>

-

Move atoms, objects or the scene

° 

PosOri<Obj|All>

-

Set/get object or scene position and orientation

° 

Pos<Obj|All>

-

Set/get object or scene position

° 

Orientation

-

Orient and rotate objects

Orient or rotate objects, continuously, until a certain orientation is reached (also in combination with a position) or to a nice view. Rotations about an arbitrary axis are also possible. The orientation angles corresponding to certain direction vectors can also be calculated.

° 

AutoOri<Obj|All>

-

Orient objects or scene automatically in a given number of steps

° 

AutoRotate<Obj|All>

-

Rotate objects or scene automatically

° 

NiceOri<Obj|All>

-

Orient objects nicely

° 

OriVec

-

Get vector orientation

° 

Ori<Obj|All>

-

Set/get object or scene orientation

° 

Rotate<Atom|Res|Mol|Obj|All>

-

Rotate atoms, objects or the scene

° 

RotAxis<Atom|Res|Mol|Obj|All>

-

Rotate atoms about a specified axis

° 

Size

-

Scale objects

Change the size of objects by scaling the atom coordinates or the vertices of a polygon mesh.

° 

Scale<Atom|Res|Mol|Obj|All>

-

Scale atom positions and polygon meshes

° 

Labels

-

Display text labels

Label anything from atoms to the entire scene and distances, change the label style including font, color or perspective, finally delete atom- and distance labels again.

° 

LabelDis

-

Label atom distances

° 

LabelPar

-

Set label parameters

° 

Label<Atom|Res|Seg|Mol|Obj|All>

-

Add labels

° 

UnlabelDis

-

Delete distances labels

° 

Unlabel<Atom|Res|Seg|Mol|Obj|All>

-

Delete labels

° 

Marks and zooms - Mark atoms with fireflies and zoom in

Mark one atom and display its properties in the head up display, then zoom in closely on one or more atoms.

° 

MarkAtom

-

Set/get atoms marked with fireflies

° 

Zoom<Atom|Res|Mol|Obj|All>

-

Zoom in on atoms

° 

Arrows

-

Show arrows connecting atoms or points

Show arrows and hide those connecting atoms or delete those connecting points.

° 

HideArrow<Atom|Res|Mol|Obj|All>

-

Hide arrows

° 

ShowArrow

-

Show arrows between atoms or points

° 

Polygons

-

Show polygons connecting atoms or points, draw rectangles

Show polygons (possibly inside rings) and hide those connecting atoms or delete those connecting points. Polygons (also those in solids) can be drawn with various lighting models, hardware tessellation and reflections of the environment. In two dimensions, you can draw filled rectangles on images, the HUD and a separate window.

° 

FillRect

-

Fill or clear rectangular area

° 

HidePolygon<Atom|Res|Mol|Obj|All>

-

Hide polygons

° 

PolygonPar

-

Set/get polygon smoothness and reflectivity

° 

ShowPolygon

-

Show polygon between atoms or points

° 

ShowRing<Atom|Res|Mol|Obj|All>

-

Show polygon inside ring

° 

Solids

-

Show spheres, boxes, pyramids, cylinders, tori and others

Show solid spheres & ellipsoids, boxes & cubes, cones, cylinders, pyramids & prisms, or a torus. Six cube maps can be spherically projected onto a sky sphere.

° 

ShowBox

-

Show a rectangular box

° 

ShowCone

-

Show a cone, cylinder, pyramid or prism

° 

ShowSphere

-

Show a sphere or ellipsoid

° 

ShowSkySphere

-

Show a spherical environment

° 

ShowTorus

-

Show a torus

° 

Images

-

Show and animate bitmaps

Load a bitmap in Windows BMP-, JPEG- or PNG-format, show it on screen, move it around or do more complicated animations and let the image disappear again. You can also swap images, attach them to objects, toggle fogging, hide them, list them and finally delete them.

° 

AnimateImage

-

Animate appearance and disappearance of images

° 

AutoMoveImage

-

Move images automatically

° 

DelImage

-

Delete images

° 

HideImage

-

Hide images

° 

ImageFog

-

Switch image fog on/off

° 

LoadBmp

-

Load image from Bmp file

° 

LoadJPG

-

Load image from JPG file

° 

LoadPNG

-

Load image from PNG file

° 

ListImage

-

List images

° 

MakeImage

-

Create empty image

° 

MakeImageObj

-

Create object with attached image

° 

ShowImage

-

Show images

° 

SwapImage

-

Swap images

° 

UnrestImage

-

Let animated image disappear

° 

Text

-

Print text, possibly in 3D letters

By default, printing is done to the console. To get fancier text output, redirect printing to a text object, an image, the HUD or a secondary window. Choose a font, possibly with fog (for 3D objects), position the cursor, then print characters.

° 

Font

-

Set font for 3D letters

° 

FontFog

-

Switch font fog on/off

° 

MakeTextObj

-

Make text object to print 3D letters

° 

PosText

-

Position and justify text

° 

Print

-

Print text

° 

PrintCon

-

Print to console

° 

PrintHUD

-

Print to head up display

° 

PrintImage

-

Print to image

° 

PrintObj

-

Print to text object

° 

PrintWin

-

Print to secondary window

° 

Wire frames - Display selected polygon meshes as wire frames

All polygon meshes can be shown as a wire frame, where only the edges connecting the mesh vertices are visible. This is a common visualization style for X-ray density. The thickness and plasticity of wire frames can be adapted.

° 

PointPar

-

Set point and line radius and plasticity in wire frames

° 

ShowWire<Obj|All>

-

Show polygon mesh as wire frame

° 

Options

-

Other commands

° 

Experiments

-

Let YASARA cook for you

Some things are non-trivial. Nevertheless, YASARA delivers the answer at the touch of the 'Experiment' button. During an experiment, YASARA takes over control and uses its 'artificial intelligence' to do various things in the right order. A message at the bottom will keep you informed. Some experiments accept additional parameters, look at the example macros to see how it works.

° 

Experiment

-

Choose and control experiments

° 

Macros

-

Watch YASARA do the work for you

Save YASARA's current state in a macro or record your input as a macro (excluding mouse movements), play back your own macros or those made by others with a higher stage of YASARA, apply them to a large number of targets or files for batch-processing, stopping whenever you want. You can use the back/forward icons in the top right corner to jump around in the macro. Macros can wait for certain events before they continue, raise errors if something goes wrong, take a certain action if an error occurs, disallow user input, speedup animations if the graphics get slow, require a minimum YASARA version, set the random number seed, and be applied to a certain target. You can save a lot of time by running macros in text console mode (start YASARA with command line parameter -con). To speed up the macro development, YASARA provides useful commands, e.g. to confine values to a given range. For benchmarking macros, the current system time can be obtained.

° 

ApplyMacro

-

Apply macro to multiple targets or files

° 

Bound

-

Bound value to interval

° 

Go

-

Go to another position in the macro

° 

MacroTarget

-

Set macro target

° 

OnError

-

Set error action

° 

PlayMacro

-

Play back macro

° 

PlayMovie

-

Play back macro as a movie

° 

RaiseError

-

Display error message

° 

RecordMacro

-

Record all following commands in a macro

° 

RandomSeed

-

Set Yanaconda random number seed

° 

RequireVersion

-

Require a minimum YASARA version

° 

SaveMacro

-

Save a macro to restore the current state

° 

SpeedUp

-

Speed up movements when graphics are slow

° 

StopMacro

-

Stop macro playback or recording

° 

SystemTime

-

Get system time

° 

UserInput

-

Set user input

° 

Wait

-

Wait for certain time period or condition

° 

Tables

-

Collect, visualize and export data

When analyzing data, you often want to visualize it. This is achieved by creating a one-, two- or three-dimensional table, selecting it for data collection, tabulating the results and showing a graphical representation of the data. Tables can also be listed and manipulated on the column, row and page level, flipped, deleted entirely, imported and exported for use with other programs like Excel and XMGrace.

° 

Tabulate

-

Add cells to table

° 

DelTab

-

Delete tables

° 

FlipTab

-

Flip table axes

° 

LoadTab

-

Load formatted table

° 

MakeTab

-

Make a table

° 

SaveTab

-

Save formatted table

° 

SelectTab

-

Select table to add cells

° 

ShowTab

-

Show table data as 3D object

° 

Tab

-

Set/get table cells

° 

Formats

-

Choose the residue output format

Many commands output a list of residues. Change the format for residue names if you log this output.

° 

FormatRes

-

Format residue output

° 

Logs

-

Redirect output to a file

Many YASARA commands, especially those in the Analyze section, write their output to the console. You can log all output or just the result of the next command to a file and stop logging at a later point.

° 

LogAs

-

Log output of next command

° 

RecordLog

-

Record all console output in a log file

° 

StopLog

-

Stop log recorder

° 

Plugins

-

Run plugins from a macro

Normally plugins are run by clicking on the options they add to the menus. In some rare cases, it may help to create a plugin input file and then run a plugin directly. If there is a bug in the plugin and it crashes, you must additionally stop it before it can be run again.

° 

RunPlugin

-

Run Python plugin

° 

SavePLI<Atom|Res|Mol|Obj>

-

Save plugin input file

° 

StopPlugin

-

Stop running plugin

° 

Default pH - Set the H+ ion concentration and residue pKas

YASARA normally assigns bond orders and protonation patterns according to pH 7.0. Here you can change this value and also assign pKas to certain residues, overriding YASARA's predictions made during the neutralization experiment.

° 

pH

-

Set/get default pH

° 

pKaRes

-

Set/get residue pKa

° 

Quantum mechanics - Configure YAPAC

YASARA provides semi-empirical quantum chemistry based on YAPAC, a derivative of James Stewart's MOPAC. Choose one of the MNDO, AM1 or PM3 methods, optimize geometries (possibly in water) and calculate formation energies.

° 

QuantumMechanics

-

Set quantum mechanics method

° 

Coordinate system - Live in a left or right handed world

YASARA's default is a left-handed coordinate system, feel free to live in a right-handed world.

° 

CoordSys

-

Set/get coordinate system

° 

Units

-

Choose your favorite units

By default, YASARA displays energies in kJ/mol. Here you can switch to kcal/mol.

° 

EnergyUnit

-

Set energy unit

° 

Parallel computations - Configure multi CPU core usage

Today's CPUs contain more than one core to speed up calculations. Here you can change the number of CPU cores YASARA should use.

° 

Processors

-

Set/get number of processors to use

° 

Input devices - Configure the interaction with YASARA

Configure the virtual keyboard for touch devices, choose between three different pointer styles, change the function of the mouse wheel or the keyboard repeat rate, activate the P5 data glove or configure the 3DConnexion controller and its buttons.

° 

Keyboard

-

Configure virtual on-screen keyboard

° 

MouseWheel

-

Assign command to mouse wheel

° 

P5

-

Set state of p5 data glove

° 

PointerStyle

-

Set style of mouse pointer

° 

RepeatKey

-

Set/get keyboard repeat rate

° 

SpaceballButton

-

Assign command to Spaceball button

° 

SpaceballPar

-

Set Spaceball parameters

° 

Shell

-

Execute shell commands

Change or print your current working directory, copy files, delete files, rename them, get their size, list directory contents and run any other shell command.

° 

CD

-

Change working directory

° 

CopyFile

-

Copy file

° 

DelFile

-

Delete file

° 

FileSize

-

Get file size

° 

ListDir

-

List directory content

° 

RenameFile

-

Rename file

° 

PWD

-

Print working directory

° 

Shell

-

Execute shell command

° 

Internet

-

Configure internet options

Change the preferred web browser and modify the timeout for internet connections. It is also possible to download files and save them locally.

° 

Browser

-

Set web browser

° 

Download

-

Download file from internet

° 

WebTimeout

-

Set timeout for internet connections

° 

Window

-

Change the display properties

° 

Location

-

Place the YASARA window

The YASARA window can be resized, cover the entire screen and be fixed on one of multiple connected screens.

° 

FullScreen

-

Switch fullscreen mode on/off

° 

Screen

-

Fix YASARA window on a certain screen

° 

ScreenSize

-

Set/get window and fullscreen size

° 

Menus

-

Change the appearance of menus and the head-up display

Adapt the style to match your operating system, animate windows in various ways, choose your favorite background texture and font, or hide all menus, including the sequence selector at the bottom and the head up display. The latter can be configured by showing or hiding selected units.

° 

AnimateWin

-

Animate Windows

° 

HideHUD<Atom|Res|Mol>

-

Hide in head-up display

° 

HUD

-

Switch head up display

° 

Menu

-

Switch menu on/off

° 

SeqSelector

-

Switch sequence selector on/off

° 

ShowHUD<Atom|Res|Mol>

-

Show in head-up display

° 

StyleWin

-

Style Windows

° 

WinFont

-

Set window font

° 

WinTexture

-

Set window background texture

° 

Messages and buttons - Communicate with the users of your macro

When writing a plugin or macro, it sometimes helps to show a text message at the bottom and hide it afterwards or show a button to click.

° 

HideMessage

-

Hide text message at the bottom

° 

ShowButton

-

Show clickable button

° 

ShowMessage

-

Show text message at the bottom

° 

Console

-

Configure the console

YASARA's command console can be extensively configured and hidden to speed up calculations and movies. Several console functions like copy/paste are explained here.

° 

Console

-

Switch console on/off

° 

ConsolePar

-

Set console parameters

° 

Antialiasing

-

Smooth is better

Toggle YASARA's built in antialiasing and note that it only affects atom balls. Activate fullscreen antialiasing separately in your OpenGL settings.

° 

Antialias

-

Switch antialiasing on/off

° 

Frequency

-

Change the frames per second and save battery power

Depending on the power of your computer, you can let YASARA update the screen more often or enter a special power saving mode when running on a notebook.

° 

FramesPerSec

-

Set screen update frequency

° 

Stereo

-

Time to touch your molecules

Choose a stereo mode and adjust the stereo parameters to let molecules fly out of the screen.

° 

Stereo

-

Set stereo mode

° 

StereoPar

-

Set stereo parameters

° 

Custom windows - Open your own windows

Open your own windows and retrieve the data entered by the user. In Linux only, you can additionally open a secondary window (possibly on a different screen) to let macros or plugins display extra information and clickable buttons.

° 

MakeWin

-

Create an empty secondary window

° 

ShowWin

-

Show a user interface window and obtain the input made

° 

Help

-

Access the user manual and solve problems

° 

Manual

-

Browse the HTML documentation

Enter the user manual at the top level, jump directly to a certain command or search for individual keywords. It is also possible to show any URL of your choice.

° 

SearchDoc

-

Search documentation

° 

ShowCom

-

Show command description

° 

ShowDoc

-

Show documentation

° 

ShowURL

-

Open a file in the web browser

° 

Installation

-

Download missing programs and set permissions

YASARA uses other programs to perform additional tasks, here you can install them. When you copied YASARA from DVD, you can correct the permissions of the installation folder.

° 

Install

-

Install accessory program

° 

PermitAccess

-

Set permissions of the YASARA install directory

° 

Index

-

All commands in alphabetic order

  • Accel<Atom|Res|Mol|Obj|All> - Set/get acceleration of atoms
  • Add<Obj|All> - Add objects to the soup
  • AddAngle - Add angle to force field
  • AddBond - Add covalent bonds
  • AddCap<Obj|All> - Add N/C-terminal capping groups
  • AddDihedral - Add dihedral to force field
  • AddDisp<Atom|Res|Mol> - Sum atom displacements to calculate cross-correlation coefficients
  • AddEnv<Atom|Res|Mol|Obj|All> - Add to environment for surface calculations
  • AddHyd<Atom|Res|Mol|Obj|All> - Add missing hydrogens
  • AddPos<Atom|Res|Mol> - Sum atom positions to calculate average and standard deviation
  • AddRes - Add terminal residue
  • AddSpring - Add bond or position restraint to force field
  • AddTer<Obj|All> - Add C-terminal oxygens
  • Align<Mol|Obj> - Align objects and molecules
  • AlignAtom - Align atoms
  • AlignMulti<Obj|All> - Align multiple objects
  • AlignPar - Set/get alignment parameters
  • AlignPDBMol - Align similar proteins from the PDB
  • Angle - Set/get angle between atoms
  • AngleVec - Get angle between two vectors
  • AnimateImage - Animate appearance and disappearance of images
  • AnimateWin - Animate Windows
  • AnnealSteps - Set simulated annealing steps
  • Antialias - Switch antialiasing on/off
  • ApplyMacro - Apply macro to multiple targets or files
  • AtomPlasma - Switch plasma inside atoms on/off
  • AtomSize - Set size of atoms
  • AtomSymbol - Switch element symbol inside atoms on/off
  • AtomTexture - Set texture style of atoms
  • AutoMove<Obj|All> - Move objects or scene automatically
  • AutoMoveImage - Move images automatically
  • AutoOri<Obj|All> - Orient objects or scene automatically in a given number of steps
  • AutoPos<Obj|All> - Position objects or scene automatically in a given number of steps
  • AutoPosOri<Obj|All> - Position and orient objects or scene automatically in a given number of steps
  • AutoRotate<Obj|All> - Rotate objects or scene automatically
  • AveragePos<Atom|Res|Mol> - Average atom positions
  • Ball<Atom|Res|Mol|Obj|All> - Style atoms as balls
  • BallStick<Atom|Res|Mol|Obj|All> - Style atoms as balls&sticks
  • BallStickRadius - Set ball and stick radii in balls&sticks
  • BFactor<Atom|Res|Mol|Obj|All> - Set/get the B-factor
  • BindEnergyObj - Calculate binding energies
  • BinDistance - Sort distances into bins to calculate the radial distribution function
  • BLAST<Res|Mol|Obj|All> - Blast protein sequence
  • Bound - Bound value to interval
  • Boundary - Set/get cell boundary
  • Brake - Simulation brake
  • Browser - Set web browser
  • BuildAtom - Build single atom
  • BuildGrid - Build a grid of atoms
  • BuildLoop - Build central or terminal loop
  • BuildMol - Build peptide or nucleic acid chain
  • BuildRes - Build single residue
  • BuildSMILES - Build molecule from SMILES string
  • BuildSymRes - Build symmetry related residues
  • CaviVol<Atom|Res|Mol|Obj|All> - Calculate cavity volumes
  • CD - Change working directory
  • Cell - Set/get simulation cell dimensions
  • Center<Atom|Res|Mol|Obj|All> - Center atoms or polygon meshes
  • Charge<Atom|Res|Mol|Obj|All> - Set/get the summed up charge
  • Check<Atom|Res|Obj|All> - Check structure quality
  • Clean<Obj|All> - Clean objects for molecular dynamics simulation
  • Clear - Clear scene
  • Color<Atom|Res|Mol|Obj|All> - Set/get atom colors
  • ColorBG - Color background
  • ColorBonds - Color bonds
  • ColorFog - Color fog
  • ColorHBo - Color hydrogen bonds
  • ColorMesh - Color polygon mesh
  • ColorPar - Set default color parameters
  • ColorSurf<Obj|All> - Color surface
  • Compare<Atom|Res> - Compare atoms and residues
  • CompareBond - Compare bonds
  • CompoundMol - Set/get compound names of molecules
  • Console - Switch console on/off
  • ConsolePar - Set console parameters
  • CoordSys - Set/get coordinate system
  • CopyFile - Copy file
  • CopyStyleObj - Copy visualization style between objects
  • CorrectCis - Correct cis-peptide bonds during a simulation
  • CorrectConv - Correct naming conventions during a simulation
  • CorrectDrift - Correct solute drift during a simulation
  • CorrectIso - Correct wrong isomers during a simulation
  • CorrectKnots - Correct knots and other entanglements during a simulation
  • Count<Atom|Res|Mol|Obj> - Count selected units
  • CountBond - Count bonds
  • Crystallize<Obj|All> - Crystallize objects to fill the unit cell
  • Cut<Obj|All> - Cut objects open
  • Cutoff - Set force cutoff distance
  • DCCM - Calculate dynamic cross-correlation matrix
  • Deflate<Atom|Res|Mol|Obj|All> - Convert 3D to 2D coordinates, creating a flat structural formula
  • DegFreedom - Get degrees of freedom
  • Del<Atom|Res|Mol|Obj|All> - Delete atoms
  • DelBond - Delete covalent bonds
  • DelFile - Delete file
  • DelHyd<Obj|All> - Delete all hydrogens
  • DelImage - Delete images
  • DelRest<Atom|Res|Mol|Obj|All> - Delete restraints
  • DelTab - Delete tables
  • DelView - Delete view
  • DelWater<Obj|All> - Delete all water molecules
  • Dihedral - Set/get dihedral angle between atoms
  • Dipole<Atom|Res|Mol|Obj> - Calculate electric dipole moments
  • Distance - Set/get distance between atoms
  • Download - Download file from internet
  • Duplicate<Obj|All> - Duplicate objects
  • DuplicateView - Duplicate view
  • ElementAtom - Get chemical element
  • Energy<Atom|Res|Mol|Obj|All> - Calculate force field energies
  • EnergyUnit - Set energy unit
  • Exit - Exit YASARA
  • Experiment - Choose and control experiments
  • FileSize - Get file size
  • FillCellObj - Fill simulation cell with object
  • FillCellWater - Fill simulation cell with water
  • FillRect - Fill or clear rectangular area
  • FirstCavi<Atom|Res> - Get first atom or residue facing each cavity and the cavity volume
  • FirstSurf<Atom|Res> - Get first atom or residue facing each surface and the surface area
  • Fix<Atom|Res|Mol|Obj|All> - Fix atoms during simulation
  • FixAngle - Constrain bond angle during simulation
  • FixBond - Constrain bond length during simulation
  • FixHydAngle - Constrain critical hydrogen bond angles during simulation
  • FlipTab - Flip table axes
  • Fog - Set fog density
  • Font - Set font for 3D letters
  • FontFog - Switch font fog on/off
  • Force<Atom|Res|Mol|Obj|All> - Set/get force on atoms
  • ForceField - Set/get force field
  • FormatRes - Format residue output
  • FormEnergy<Atom|Res|Mol|Obj|All> - Calculate formation energies
  • FramesPerSec - Set screen update frequency
  • Free<Atom|Res|Mol|Obj|All> - Free atoms during simulation
  • FreeAngle - Free bond angle during simulation
  • FreeBond - Remove bond length constraint during simulation
  • FullScreen - Switch fullscreen mode on/off
  • GDT<Atom|Res|Mol|Obj> - Calculate global distance test
  • Go - Go to another position in the macro
  • Grab<Obj|All> - Grab object or scene for mouse movement
  • GrabNext - Grab next object for mouse movement
  • GrabPrev - Grab previous object for mouse movement
  • Group<Atom|Res|Mol|Obj|All> - Add atoms to group
  • GroupAngle - Calculate angle between two atom groups
  • GroupBox - Calculate bounding box around atom group
  • GroupCenter - Calculate geometric center or center of mass
  • GroupDihedral - Calculate dihedral angle between two atom groups
  • GroupDistance - Calculate distance between two atom groups
  • GroupLine - Calculate optimal line through atom group
  • GroupPlane - Calculate optimal plane through atom group
  • Hide<Atom|Res|Mol|Obj|All> - Hide atoms
  • HideArrow<Atom|Res|Mol|Obj|All> - Hide arrows
  • HideHBo<Atom|Res|Mol|Obj|All> - Hide hydrogen bonds
  • HideHUD<Atom|Res|Mol> - Hide in head-up display
  • HideImage - Hide images
  • HideMessage - Hide text message at the bottom
  • HidePolygon<Atom|Res|Mol|Obj|All> - Hide polygons
  • HideRest<Atom|Res|Mol|Obj|All> - Hide restraints
  • HideSecStr<Res|Mol|Obj|All> - Hide secondary structure
  • HideSurf<Atom|Res|Mol|Obj|All> - Hide surface
  • HideTrace - Hide trace through atoms
  • HUD - Switch head up display
  • ImageFog - Switch image fog on/off
  • Inflate<Atom|Res|Mol|Obj|All> - Generate 3D coordinates for flat or distorted molecules
  • Install - Install accessory program
  • Interactions - Set force field terms
  • IntersectObj - Perform collision detection to find intersecting objects
  • Join<Atom|Res|Mol> - Delete split points
  • JoinObj - Join objects to one final object
  • KekulizeBond - Remove fractional bond orders
  • Keyboard - Configure virtual on-screen keyboard
  • KinEnergy<Atom|Res|Mol|Obj|All> - Calculate kinetic energy
  • Label<Atom|Res|Seg|Mol|Obj|All> - Add labels
  • LabelDis - Label atom distances
  • LabelPar - Set label parameters
  • LightSource - Configure the light source
  • Link<Atom|Res|Mol|Obj|All> - Find bonds automatically
  • List<Atom|Res|Mol|Obj> - List selection
  • ListBond - List bonds
  • ListCon<Atom|Res|Mol|Obj> - List contacts
  • ListDir - List directory content
  • ListFloat<Obj|All> - List floating assignments
  • ListHBo<Atom|Res|Mol|Obj> - List hydrogen bonds
  • ListImage - List images
  • ListInt<Atom|Res|Mol|Obj> - List interactions
  • ListRest<Atom|Res|Mol|Obj|All> - List restraints and energies
  • ListSMARTS - List atoms matching SMARTS string
  • ListSMILES - List atoms matching SMILES string
  • Load* - Import file with OpenBabel
  • LoadBmp - Load image from Bmp file
  • LoadCIF - Load CIF or mmCIF file
  • LoadESP - Load and visualize electrostatic potential
  • LoadJPG - Load image from JPG file
  • LoadMDCrd<Obj|All> - Load simulation snapshot in MDCrd format
  • LoadPDB - Load Protein Data Bank file
  • LoadPNG - Load image from PNG file
  • LoadPrep - Load AMBER Prep topology
  • LoadSce - Load complete scene
  • LoadSim - Load simulation snapshot in sim format
  • LoadTab - Load formatted table
  • LoadTbl - Load distance, dihedral and rdc restraints in XPLOR format
  • LoadXTC<Obj|All> - Load simulation snapshot in XTC format
  • LoadYOb - Load YASARA object
  • LogAs - Log output of next command
  • Longrange - Set long range interactions
  • MacroTarget - Set macro target
  • MakeImage - Create empty image
  • MakeImageObj - Create object with attached image
  • MakeTab - Make a table
  • MakeTextObj - Make text object to print 3D letters
  • MakeWin - Create an empty secondary window
  • MarkAtom - Set/get atoms marked with fireflies
  • Mass<Atom|Res|Mol|Obj|All> - Calculate mass
  • Menu - Switch menu on/off
  • MinStep - Set energy minimization step
  • MouseWheel - Assign command to mouse wheel
  • Move<Atom|Res|Mol|Obj|All> - Move atoms, objects or the scene
  • MoveMesh - Move polygon mesh
  • Name<Atom|Res|Seg|Mol|Obj> - Set/get names of objects, segments, molecules, residues and atoms
  • Name3 - Convert residue names from 1- to 3-letter code
  • NiceOri<Obj|All> - Orient objects nicely
  • Occup<Atom|Res|Mol|Obj|All> - Set/get the occupancy
  • Oligomerize<Obj|All> - Oligomerize objects to generate the biologically active form
  • OnError - Set error action
  • OptHyd<Obj|All> - Optimize hydrogen bonding network
  • Optimize<Res|Mol|Obj|All> - Optimize molecular geometry
  • OptimizeLoop - Optimize central or terminal loop
  • Ori<Obj|All> - Set/get object or scene orientation
  • OriVec - Get vector orientation
  • P5 - Set state of p5 data glove
  • PermitAccess - Set permissions of the YASARA install directory
  • pH - Set/get default pH
  • pKaRes - Set/get residue pKa
  • PlayMacro - Play back macro
  • PlayMovie - Play back macro as a movie
  • PointerStyle - Set style of mouse pointer
  • PointPar - Set point and line radius and plasticity in wire frames
  • PolygonPar - Set/get polygon smoothness and reflectivity
  • Pos<Atom|Res|Mol> - Set/get atom positions
  • Pos<Obj|All> - Set/get object or scene position
  • PosOri<Obj|All> - Set/get object or scene position and orientation
  • PosText - Position and justify text
  • PredSecStr<Res|Mol|Obj|All> - Predict secondary structure
  • PressureCtrl - Set pressure control
  • Print - Print text
  • PrintCon - Print to console
  • PrintHUD - Print to head up display
  • PrintImage - Print to image
  • PrintObj - Print to text object
  • PrintWin - Print to secondary window
  • Processors - Set/get number of processors to use
  • Projection - Set perspective or parallel projection
  • Prop<Atom|Res|Mol|Obj|All> - Set/get the property value
  • PWD - Print working directory
  • QuantumMechanics - Set quantum mechanics method
  • Radius<Atom|Res|Mol|Obj|All> - Calculate the radius
  • RaiseError - Display error message
  • RandomSeed - Set Yanaconda random number seed
  • RayTrace - Create raytraced screenshot using POVRay
  • RDF - Calculate radial distribution function
  • RecordLog - Record all console output in a log file
  • RecordMacro - Record all following commands in a macro
  • Redo - Redo changes
  • Regularize<Obj|All> - Regularize covalent geometry (Twinset)
  • Remove<Obj|All> - Remove objects from the soup
  • RemoveEnv<Atom|Res|Mol|Obj|All> - Remove from environment for surface calculations
  • RenameFile - Rename file
  • Renumber<Obj|All> - Renumber objects
  • RenumberAtom - Renumber atoms
  • RenumberRes - Renumber residues
  • RepeatKey - Set/get keyboard repeat rate
  • ReplaceRes - Replace residues
  • RequireVersion - Require a minimum YASARA version
  • Reset - Reset YASARA to startup state
  • ResonateBond - Introduce fractional bond orders
  • RestEnergy<Obj|All> - Calculate restraint energies
  • RestrainDih - Restrain dihedral angle
  • RestrainDis - Restrain distance
  • RestrainPar - Set/get restraining parameters
  • RestrainPot - Set/get restraining potential functions
  • RestViol<Obj|All> - Get restraint violation statistics
  • RMSD<Atom|Res|Mol|Obj> - Calculate RMSDs
  • RMSF<Atom|Res|Mol> - Calculate root mean square fluctuations and B-factors
  • Rotate<Atom|Res|Mol|Obj|All> - Rotate atoms, objects or the scene
  • RotAxis<Atom|Res|Mol|Obj|All> - Rotate atoms about a specified axis
  • RunPlugin - Run Python plugin
  • SampleDih - Sample dihedral angles
  • SampleLoop - Sample central or terminal loop
  • Save* - Export file with OpenBabel
  • SaveAli - Save alignment between objects
  • SaveBmp - Save screenshot as uncompressed Windows bitmap
  • SaveCIF - Save CIF or mmCIF file
  • SaveESP - Save electrostatic potential map
  • SaveMacro - Save a macro to restore the current state
  • SaveMDCrd - Save simulation snapshots in MDCrd format
  • SaveMPG - Save MPEG video
  • SavePDB - Save Protein Data Bank file
  • SavePLI<Atom|Res|Mol|Obj> - Save plugin input file
  • SavePNG - Save screenshot as compressed PNG bitmap
  • SavePOV - Save POVRay scene description
  • SavePrep<Res|Mol|Obj|All> - Save AMBER Prep topology
  • SaveSce - Save complete scene
  • SaveSeq<Res|Mol|Obj> - Save residue sequence
  • SaveSim - Save simulation snapshots in sim format
  • SaveTab - Save formatted table
  • SaveTbl - Save XPLOR distance and dihedral angle restraints
  • SaveWOb - Save Alias/Wavefront object
  • SaveXTC - Save simulation snapshots in XTC format
  • SaveYOb - Save YASARA object
  • Scale<Atom|Res|Mol|Obj|All> - Scale atom positions and polygon meshes
  • ScaleForce - Set/get force scaling factors
  • ScaleRest<Atom|Res|Mol|Obj|All> - Scale restraints
  • Screen - Fix YASARA window on a certain screen
  • ScreenSize - Set/get window and fullscreen size
  • SearchDoc - Search documentation
  • SecStr<Res|Mol|Obj|All> - Set/get secondary structure
  • SecStrPar - Set secondary structure display parameters
  • Seg<Atom|Res|Mol|Obj|All> - Set/get the segment name
  • Select<Atom|Res|Mol|Obj|All> - Select atoms
  • SelectArea<Atom|Res|Mol|Obj> - Interactively select atoms within an arbitrary area
  • SelectBox<Atom|Res|Mol|Obj> - Interactively select atoms within a rectangular box
  • SelectSphere<Atom|Res|Mol|Obj> - Interactively select atoms within a sphere around other atoms
  • SelectTab - Select table to add cells
  • SeqSelector - Switch sequence selector on/off
  • Sequence<Res|Mol|Obj|All> - Get residue sequence
  • Shell - Execute shell command
  • ShiftColor<Atom|Res|Mol|Obj|All> - Shift atom colors
  • Show<Atom|Res|Mol|Obj|All> - Show atoms
  • ShowArrow - Show arrows between atoms or points
  • ShowBox - Show a rectangular box
  • ShowButton - Show clickable button
  • ShowCavi<Atom|Res|Mol|Obj|All> - Show cavities
  • ShowCell - Create a simulation cell object to visualize neighboring cells
  • ShowCom - Show command description
  • ShowCon<Atom|Res|Mol|Obj> - Show contacts
  • ShowCone - Show a cone, cylinder, pyramid or prism
  • ShowDoc - Show documentation
  • ShowESP - Show electrostatic potential
  • ShowGrid - Show simulation neighbor search grid
  • ShowHBo<Atom|Res|Mol|Obj|All> - Show hydrogen bonds
  • ShowHUD<Atom|Res|Mol> - Show in head-up display
  • ShowImage - Show images
  • ShowInt<Atom|Res|Mol|Obj> - Show interactions
  • ShowIonSites<Obj|All> - Show ion binding sites
  • ShowKBP - Show knowledge-based potential
  • ShowMessage - Show text message at the bottom
  • ShowPolygon - Show polygon between atoms or points
  • ShowRest<Atom|Res|Mol|Obj|All> - Show restraints
  • ShowRing<Atom|Res|Mol|Obj|All> - Show polygon inside ring
  • ShowRota<Res|Mol|Obj|All> - Show side-chain rotamers (Twinset)
  • ShowSecStr<Res|Mol|Obj|All> - Show secondary structure
  • ShowSkySphere - Show a spherical environment
  • ShowSphere - Show a sphere or ellipsoid
  • ShowSurf<Atom|Res|Mol|Obj|All> - Show surface
  • ShowTab - Show table data as 3D object
  • ShowTorus - Show a torus
  • ShowTrace - Show trace through atoms
  • ShowURL - Open a file in the web browser
  • ShowView - Show view
  • ShowWin - Show a user interface window and obtain the input made
  • ShowWire<Obj|All> - Show polygon mesh as wire frame
  • Sim - Set/get simulation state
  • SimSpeed - Set simulation speed
  • SimSteps - Set/get number of simulation steps per screen and pairlist update
  • SolvDensity - Get solvent density in simulation cell
  • SolvEnergy<Atom|Res|Mol|Obj|All> - Calculate solvation energy
  • SolvPar - Set/get solvation parameters
  • SpaceballButton - Assign command to Spaceball button
  • SpaceballPar - Set Spaceball parameters
  • Span<Atom|Res|Obj> - Determine first and last unit spanning a selection
  • Speed<Atom|Res|Mol|Obj|All> - Set/get speed and velocity of atoms
  • SpeedUp - Speed up movements when graphics are slow
  • Split<Obj|All> - Split objects at split points
  • Split<Atom|Res|Mol> - Introduce split points
  • Stereo - Set stereo mode
  • StereoPar - Set stereo parameters
  • Stick<Atom|Res|Mol|Obj|All> - Style atoms as sticks
  • StickRadius - Set stick radius
  • StopLog - Stop log recorder
  • StopMacro - Stop macro playback or recording
  • StopPlugin - Stop running plugin
  • Style - Set general display style
  • StyleWin - Style Windows
  • Sup<Atom|Res|Mol|Obj> - Superpose objects
  • SupMulti<Atom|Res|Mol|Obj> - Superpose multiple objects
  • SupOrdered<Atom|Res|Mol> - Superpose objects on ordered units
  • Surf<Atom|Res|Mol|Obj|All> - Calculate surface areas
  • SurfDis<Atom|Res|Mol|Obj> - Calculate distance from surface
  • SurfESP<Atom|Res|Mol|Obj|All> - Calculate electrostatic surface potentials
  • SurfPar - Set/get surface parameters
  • SwapAtom - Swap chemical element of atoms
  • SwapBond - Swap order of covalent bonds
  • SwapHyd<Obj|All> - Swap hydrogen ordering in residues
  • SwapImage - Swap images
  • SwapObj - Swap two objects in the list
  • SwapPosAtom - Swap atom positions
  • SwapRes - Swap residue side-chains
  • Switch<Obj|All> - Switch objects on/off
  • SystemTime - Get system time
  • Tab - Set/get table cells
  • Tabulate - Add cells to table
  • Temp - Set/get simulation temperature
  • TempCtrl - Set temperature control
  • Time - Set/get simulation time
  • TimeStep - Set simulation timestep
  • Transfer<Obj|All> - Transfer objects into another coordinate system
  • Transform<Obj|All> - Transform objects
  • Transformation - Get previously applied transformations
  • Twist<Mol|Obj> - Twist objects to improve structural alignment
  • TypeAtom - Get the atom type
  • TypeBond - Assign bond orders automatically
  • Undo - Undo changes
  • UndoLevels - Set number of undo levels
  • Ungroup<Atom|Res|Mol|Obj|All> - Remove atoms from group
  • Unlabel<Atom|Res|Seg|Mol|Obj|All> - Delete labels
  • UnlabelDis - Delete distances labels
  • UnrestImage - Let animated image disappear
  • Unselect<Atom|Res|Mol|Obj|All> - Unselect atoms
  • UserInput - Set user input
  • Volume<Atom|Res|Mol|Obj|All> - Calculate volumes
  • Wait - Wait for certain time period or condition
  • WarnIsError - Treat warnings as errors
  • WebTimeout - Set timeout for internet connections
  • WinFont - Set window font
  • WinTexture - Set window background texture
  • Zoom<Atom|Res|Mol|Obj|All> - Zoom in on atoms