CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)





To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). MacOS tries to hide the yasara directory from you: open Finder, browse to the YASARA application and click on 'Show package contents' in the context menu to see the yasara directory.

If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.


What's new in YASARA Structure

Figure: A snapshot from the movie
An overview of the new features in YASARA Structure

Written by: Elmar Krieger & James Magahern

License: GNU GPL

Last modified: 2019/01/28

Download: structure.zip


Working with the Twinset

Figure: A snapshot from the movie
An introduction to using WHAT IF from within YASARA. Many thanks to Sven Geier for his 'Sigmaspace' background (more at www.sgeier.net/fractals).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/01/18

Download: twinset.zip


Working with YASARA

Figure: A snapshot from the movie
A tutorial explaining how to work with YASARA to new users. Many thanks to Sven Geier for his 'Planetary' background (more at www.sgeier.net/fractals).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2018/10/29

Download: welcome.zip


Virtual reality

Figure: A snapshot from the movie
A tutorial explaining how to use the YASARA Virtual Reality Workstation on Android. It covers setting up the VR headset, molecular graphics, interactive MD and drug design.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2018/09/11

Download: vrintro.zip


What's new in YASARA for Android

Figure: A snapshot from the movie
A little intro about YASARA on Android smartphones and tablets

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2018/03/20

Download: android.zip



Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).


Send a bug report by e-mail

This plugin sends a bug report, together with the latest execution log (stored as yasara/log/exec_*.log), click Help > Report error. It also adds an option to request YASARA updates, click Help > Check for update and Help > Request update.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/03/15

Download: reporter.zip