Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


LGPL Compliance Information

The LGPL is a license provided by the Free Software Foundation to ease the coexistance of commercial and free software. You can read the license here. YASARA is linked with the Simple Direct Media Layer library and fragments of the GNU C library that are released under the LGPL.
The LGPL requires mainly two things:

  1. That the source code of the libraries is made available. Click here to download YASARA's version of the SDL library. Click here to download the patch applied to the original SDL library.
  2. That the program is provided in a form that allows you to dynamically link your own versions of the libraries. To get a dynamically linkable YASARA, go to the update page, and input LGPL in the version number field.

NOTE: We cannot provide support if YASARA is dynamically linked with other versions of the libraries. If you nevertheless want to try, here are some hints: The Windows version of SDL was patched to add support for event timestamps. YASARA will therefore only work with its own SDL library. The Linux version of SDL had to be statically linked, because of two issues: 1) Most default Linux installations contain SDL libraries without quad-buffered stereo support. Updating SDL requires root privileges, which many users don't have. 2) When YASARA is dynamically linked with SDL, it sometimes freezes in the pthread library on startup, if the SDL library and YASARA were compiled with different versions of GCC. This behavior was confirmed for Suse Linux 8.0.

GPL Compliance Information

The GPL is a more restrictive license, which does not allow linking of GPLed and non-GPLed software. YASARA is shipped with OpenBabel, a GPLed collection of conversion tools for molecular file formats. By default, you will only find the OpenBabel executable in subdirectory yasara/bab. Support for reading/writing YASARA objects has been added to OpenBabel, and until it appears in the official release, you can download the modified source code here.