Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 


LGPL Compliance Information

The LGPL is a license provided by the Free Software Foundation to ease the coexistance of commercial and free software. You can read the license here.

YASARA is linked with the following libraries licensed with the LGPL:

  • The FFMPEG library using LGPL v2.1, you can find the license in the yasara/mpg folder.

The LGPL requires mainly two things:

  1. That the source code of the libraries is made available, you can obtain it from source@yasara.org.
  2. That the program is provided as object code that allows you to link your own versions of the libraries. To get the YASARA object code, go to the update page, and input LGPL in the version number field.

NOTE: We cannot provide support if YASARA is linked with other versions of the libraries.

GPL Compliance Information

The GPL is a more restrictive license, which does not allow linking of GPLed and non-GPLed software. YASARA is shipped with the following applications licensed with the GPL (the source code can be obtained from source@yasara.org):

  • APBS, a software for solving the Poisson-Boltzmann equation to calculate solvation energies. The license is in yasara/pbs/copying.
  • AutoDock, a software for ligand docking. The license is in yasara/ado/autodock_copying.
  • OpenBabel, a collection of conversion tools for molecular file formats. The license is in yasara/bab/copying.
  • POV-Ray, a ray-tracing software for photo-realistic images. The license is in yasara/pov/copying.
  • Theseus, a tool for maximum likelihood superpositioning. The license is in yasara/ths/copying.
  • VINA, another software for ligand docking. The license is in yasara/ado/vina_copying.