Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Lighting and shadows in YASARA

The successful scientific exploration of a macromolecule depends to a large extent on the visualization capabilities of the software. YASARA's OpenGL-based graphics engine is under continuous development to provide you with the most responsive and informative window into the virtual world. To optimally support the perception of depth and molecular structure even in non-stereo modes, YASARA features advanced lighting effects:

  • Direct lighting: depending on the position of the main light source, atoms cast shadows onto each other.
  • Ambient lighting: atoms block the ambient light on its way into the protein.
  • Fog: distant atoms appear darker.

All these features avoid the use of the newly introduced 'vertex and pixel shaders'  and will thus also work correctly on somewhat older hardware and video drivers.


Figure 1: A hypothetical protein from H.influenzae with real-time shadows and ambient lighting. Many thanks to Sven Geier for his 'Thetaspace' background.

Figure 2: A misfolded protein fragment entering the scene, the lightsource is now on the far right side.

Figure 3: Four misfolded protein fragments, the lightsource has been moved to the back.

Figure 4: The chaperonine GroEL with the GroES cap attaching.