Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA's cross-platform features

Obtaining YASARA is truly simple: only 3 clicks are needed to download, install and run YASARA. You can also move the 'yasara' folder to a different place on your hard disk and run from there, or simply delete it to uninstall. Or copy it to a USB stick and create your own mobile molecular modeling laboratory - you can then even run YASARA from the USB stick directly, no matter if you plug it into a computer running Windows, Linux or Mac OS X: YASARA simply adapts the look of its user interface (see below), but otherwise all functions remain where you expect them.

YASARA for Windows 7 and Vista


YASARA for Linux


YASARA for MacOSX


YASARA for Windows XP