Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA for MacOS

Thanks to Apple's switch to Intel processors in spring 2006, the cost for porting YASARA to MacOS dropped to a level that made the project worth realizing. Since February 2007, YASARA for MacOS is officially available. YASARA requires an Intel based Mac, it does not run on the old PowerPC based hardware.

While Darwin, the Unix/BSD core on which MacOS is built, normally makes porting C/C++ applications a trivial task, this rule of thumb did not hold for YASARA: in order to provide you with the highest possible performance and visual quality, YASARA directly accesses the CPU's vector registers (SSE/AVX) using assembler code. This is not a common approach in MacOS, and consequently several technical issues raised the costs, just like lots of technical problems lurking around below the shiny surface of MacOS. Higher costs combined with a smaller user base unfortunately forced us to set the price tag for YASARA MacOS 20% higher than the other versions. But therefore you get an application that is specifically tailored to MacOS, including special support for the MacBook track pad, the Mighty Mouse and multi-monitor configurations.

In addition, there are two ways to avoid the price premium:

  1. As soon as your summed up contribution to YASARA development exceeds 1000 EUR (academic) or 5000 EUR (commercial), no more MacOS price premium will be asked.
  2. If you help grow the YASARA MacOS user base by pointing your colleagues to this site, the price premium will be removed entirely as soon as there are enough users. The current ratio Windows:Linux:MacOS is 51:37:12 (in 2016, was 49:36:14 in 2014, 47:39:14 in 2011, 51:37:12 in 2009, and 57:41:2 in 2008), and MacOS should reach up to either Linux or Windows. Currently MacOS is unfortunately in decline, because Apple has essentially given up on high-performance scientific computing (lacking top CPUs and GPUs with reliable and up2date cross-platform graphics drivers).

MacOS
12 YASARAs in parallel

The screenshot above shows 12 YASARA instances running on a MacBook Pro with Retina display. You can choose between four scaling factors for the user interface.  1× yields plenty of space as shown above, 2× yields the normal MacOS size, 3× and 4× are good for extreme resolution 8K screens and presentations with high-resolution beamers. Click the image for the full size screenshot.

MacOS Screen shot