Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA for Mac OS X

Thanks to Apple's switch to Intel processors in spring 2006, the cost for porting YASARA to Mac OS X dropped to a level that made the project worth realizing. Since February 2007, YASARA for Mac OS X is officially available. YASARA requires an Intel based Mac, it does not run on the old PowerPC based hardware.

While Darwin, the Unix/BSD core on which Mac OS X is built, normally makes porting C/C++ applications a trivial task, this rule of thumb did not hold for YASARA: in order to provide you with the highest possible performance and visual quality, YASARA directly accesses the CPU's vector registers (MMX/(S)SSE1-3) using assembler code. This is not a common approach in Mac OS X, and consequently several technical issues raised the costs, e.g. the need to reengineer 100000 lines of assembler code to fulfill Mac OS X stack alignment requirements. Higher costs combined with a (currently still) smaller user base unfortunately forced us to set the price tag for YASARA Mac OS X 20% higher than the other versions. But therefore you get an application that is specifically tailored to Mac OS X, including special support for the MacBook track pad, the Mighty Mouse and multi-monitor configurations.

In addition, there are two ways to avoid the price premium:

  1. As soon as your summed up contribution to YASARA development exceeds 1000 EUR (academic) or 5000 EUR (commercial), no more Mac OS X price premium will be asked.
  2. If you help grow the YASARA Mac OS X user base by pointing your colleagues to this site, the price premium will be removed entirely as soon as there are enough users. The current ratio Windows:Linux:MacOSX is 51:37:12 (in 2016, was 49:36:14 in 2014, 47:39:14 in 2011, 51:37:12 in 2009, and 57:41:2 in 2008), and Mac OS X should reach up to either Linux or Windows. Currently MacOSX is unfortunately in decline, because Apple has essentially given up on high-performance computing (lacking top CPUs and GPUs with reliable drivers, and focusing on the proprietary Metal graphics API).

MacOS X


MacOSX Screen shot