Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Analysis of molecular dynamics trajectories in YASARA


Having run a molecular dynamics simulation, extracting the answers to your questions from the trajectory is the final step to a successful research project. Unfortunately MD trajectory analysis is often a big hurdle, since there are infinitely many things to investigate, and pre-built software can often not do exactly what you are looking for.

YASARA offers a very different approach, which gives you the freedom to design your own analysis with minimal efforts, building on a large number of existing analyses and examples.

YASARA will not just create a text file with results, but instead write a detailed scientific report about the analysis for you, with plots and tables ready for publication. Look at the automatically created report for an MD simulation of the CCR5 chemokine receptor with bound Maraviroc, which inhibits entry of HIV. The simulation of this membrane protein has also been run automatically, using only PDB file 4MBS and YASARA's membrane protein simulation protocol.

 The default analysis includes the following tables, images and plots in the report:

  • Composition of the simulated system: atoms, residues, molecules, waters, ions.
  • Automatic identification of the ligand (if present).
  • Ray-traced images of the complete system, the solute and the ligand.
  • Size of the simulation cell to see how pressure coupling influenced the simulation.
  • Potential energy and energy components
  • Protein secondary structure content
  • Surface areas of the solute: Van der Waals, molecular (Conolly) and solvent accessible surfaces.
  • Number of hydrogen bonds within the solute and between solute and solvent, helps to monitor protein folding events.
  • List of hydrogen bonds made be the ligand.
  • Radius of gyration of the solute.
  • Calpha, backbone and all-atom RMSDs of the solute with respect to the starting- or another reference structure.
  • Ligand movement RMSD (calculated after superposing the receptor) and ligand internal conformation RMSD (calculated after superposing the ligand).
  • Calculation of the time-average solute structure.
  • Identification of the minimum-energy solute structure.
  • Calculation of Root Mean Square Fluctuations (RMSFs), plotting the resulting per-residue B-factors of the solute.
  • Calculation of the Dynamic Cross Correlation Matrix (DCCM) and visualization not only of the matrix, but also of the correlated motions directly in the protein structure.
  • Creation of high-resolution plots for direct inclusion in scientific articles.

As mentioned above, there are infinitely many things to analyze, so it is likely that your specific question is not answered by the default report above. YASARA makes it as easy as possible to add your own analysis to the report. Often typing a single line is enough to create the plot you need. For example to analyze the distance between the HN5 hydrogen of Maraviroc residue MRV and the OH atom of TYR 251, the following line needs to be added to the analysis:

 Plot "Distance HN5 Res MRV,OH Res TYR 251",
      'Length of Maraviroc N5 hydrogen bond', 
'H-bond length','MrvTyrDis'

The example above measures the hydrogen bond length in each MD snapshot, adds the measurements to the result table as a new column named 'MrvTyrDis', and adds a plot named 'Length of Maraviroc N5 hydrogen bond' to the report, with the Y-axis labeled 'H-bond length'.



Molecular dynamics analysis report

Figure 1: Start of automatically generated report for a molecular dynamics simulation of the membrane protein 'CCR5 receptor'. The full report is available here.