Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 


Download / Order / Quotation Request


If this web order form does not suit your needs, just email us:
Email contact

In October 2023, we published an open access article on YASARA Model (J.Chem.Inf.Model 63,6177-6182), promising that YASARA Model would be freely available for academic users for at least two years after publication. Since YASARA development is completely financed by its users, we will evaluate the impact of this free offer on our sales in January 2026 and then decide how to continue. You can easily help to keep YASARA Model available for free if you purchase YASARA Dynamics or YASARA Structure - if our sales go up, we won't change a winning team.

You will receive a download link by email. If you selected a commercial license, you will additionally get an invoice which you can pay by bank transfer, credit card or PayPal. If you can only pay by check, please add 100 EUR for bank fees.

Note that you can also use the form below to request a quotation without placing an order. If you plan to order YASARA for multiple users/group leaders or more than one year of support, visit the license fee page for detailed pricing information.

Please customize your personal edition of
YASARA Model

Your operating system:
Your preferred bits:
Your processor:
Type of usage:
Update and support years for commercial orders:
To read about the benefits of ordering more than one year click here.
Please use only plain English characters in the fields below.
Your first name:
Your Middle initials:
Your family name:
Department,Room:
University/Company:
Street,Number:
ZIP(Postcode):
City,State:
Country:
Please doublecheck the email address, it is essential for downloads, updates and support.
What shall we do?




YASARA is linked with libraries released under the GNU LPGL. Click here for LGPL compliance information.