Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


Distributed Computing Clusters for free

Models@Home is a distributed computing environment that follows the spirit of the famous Seti@Home project, but is not tied to a specific application. Instead you can run all your favourite programs in parallel, without any need to modify or adapt them. Models@Home was developed at the CMBI, where we use it mainly for large scale molecular modeling (hence the name. Images are available here). It is designed for use in heterogeneous Linux / Windows environments based on the SDL library and works as a screen saver that becomes active as soon as the computer is idle. (The screen saver is however not obligate, it can also be used in true, dedicated clusters.) Models@Home is freely available for download, including the source code.

Distributed computing with a screen saver approach like Models@Home offers the best possible price/ performance ratio:

  • No need to buy hardware, just abuse the PCs you already have in your LAN.
  • No additional "hidden costs" for electricity, as PCs would have been running anyway.
  • No additional costs for hardware maintenance.
  • No parallel programming nightmare: just add seven lines of code to your inner loop.

Models@Home was introduced at the CMBI Mini-Symposium on Distributed Computing in Bioinformatics on May 21st, 2001, with all the details published as "Models@Home: distributed computing in bioinformatics using a screensaver based approach", E.Krieger & G.Vriend (2002), Bioinformatics 18, 315-318.

Solve your problems overnight and download now!

Fig.1: The Models@Home screen saver, with some nice models hopping around (like the famous chaperonin GroEL/ES, the transcription factor MyoD or the ribonuclease inhibitor). Even though Models@Home is politically correct (50% female and 50% male models), we are aware that some labs are suffering from strict policies. These animations can therefore be disabled.
Fig.2: There are 30 different background pictures from some of the world's top places.
Fig.3: Models@Home data flow. Abbreviations: ID = Idle Detection module, Exec = Program execution module, ScrSaver = graphical screen saver module, App 1+2 = application 1+2, TCP/IP = Transmission Control Protocol / Internet Protocol, NFS = Network File System. In a true cluster, the ID and ScrSaver modules would not be present on the clients (= "nodes").