CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

YASARA in press

Please also send us the PubMed ID in case you use YASARA yourself and have a paper to be added here, which mentions YASARA. To find PDB structures determined with the help of YASARA, search for "PDB ID".

In silico chemical-protein docking and molecular dynamics
Wijeyesakere SJ, Richardson RJ
From the book Computational Systems Pharmacology and Toxicology, 2017 Mar 03.
Characterization of surface binding sites in glycoside hydrolases: A computational study.
Samaei-Daryan S, Goliaei B, Ebrahim-Habibi A.
J Mol Recognit. 2017 Mar 15. doi: 10.1002/jmr.2624. [Epub ahead of print]
Theoretical studies on the interaction between the nitrile-based inhibitors and the catalytic triad of Cathepsin K.
Pitchumani Violet Mary C, Shankar R, Vijayakumar S.
J Biomol Struct Dyn. 2017 Feb 20:1-22. doi: 10.1080/07391102.2017.1289863
Refining the reaction mechanism of O2 towards its co-substrate in cofactor-free dioxygenases.
Silva PJ.
PeerJ. 2016 Dec 20;4:e2805. doi: 10.7717/peerj.2805. eCollection 2016.
Structural, Functional and Phylogenetic Analysis of Sperm Lysozyme-Like Proteins.
Kalra S, Pradeep MA, Mohanty AK, Kaushik JK.
PLoS One. 2016 Nov 10;11(11):e0166321. doi: 10.1371/journal.pone.0166321.
Phosphorylation of Cytochrome c Threonine 28 Regulates Electron Transport Chain Activity in Kidney: Implications for AMP Kinase.
Mahapatra G, Varughese A, Ji Q, Lee I, Liu J, Vaishnav A, Sinkler C, Kapralov AA, Moraes CT, Sanderson TH, Stemmler TL, Grossman LI, Kagan VE, Brunzelle JS, Salomon AR, Edwards BF, Huettemann M.
J Biol Chem. 2016 Oct 7. pii: jbc.M116.744664.
Molecular interaction of d-conopeptide EVIA with voltage-gated Na(+) channels.
Tietze D, Leipold E, Heimer P, Boehm M, Winschel W, Imhof D, Heinemann SH, Tietze AA.
Biochim Biophys Acta. 2016 Sep;1860(9):2053-63. doi:
Characterization of the structure and catalytic activity of Legionella pneumophila VipF.
Young BH, Caldwell TA, McKenzie AM, Kokhan O, Berndsen CE.
Proteins. 2016 Oct;84(10):1422-30. doi: 10.1002/prot.25087. Epub 2016 Jul 5.
Connecting common genetic polymorphisms to protein function: A modular project sequence for lecture or lab.
Berndsen CE, Young BH, McCormick QJ, Enke RA.
Biochem Mol Biol Educ. 2016 Jun 9. doi: 10.1002/bmb.20976.
A Homology Model of Xyloglucan Xylosyltransferase 2 Reveals Critical Amino Acids Involved in Substrate Binding.
Culbertson AT, Tietze AA, Tietze D, Chou YH, Smith AL, Young ZT, Zabotina OA.
Glycobiology. 2016 May 4. pii: cww050.
In Silico Structure and Sequence Analysis of Bacterial Porins and Specific Diffusion Channels for Hydrophilic Molecules: Conservation, Multimericity and Multifunctionality.
Vollan HS, Tannaes T, Vriend G, Bukholm G.
Int J Mol Sci. 2016 Apr 21;17(4). pii: E599. doi: 10.3390/ijms17040599.
The Disulfide Bonds within BST-2 Enhance Tensile Strength during Viral Tethering.
Du Pont KE, McKenzie AM, Kokhan O, Sumner I, Berndsen CE.
Biochemistry. 2016 Feb 16;55(6):940-7. doi: 10.1021/acs.biochem.5b01362. Epub
Applications of Receptor- and Ligand-based Models in Inverse Docking Experiments: Recognition of Dihydrofolate Reductase Using 7,8-Dialkyl- 1,3-Diaminopyrrolo[3,2-f]Quinazolines.
Kumar SP, Jasrai YT, Pandya HA.
Curr Comput Aided Drug Des. 2016;12(1):15-28.
Stepwise Versus Concerted Mechanism in General-Base Catalysis by Serine Proteases.
Uritsky N, Shokhen M, Albeck A.
Angew Chem Int Ed Engl. 2015 Dec 21. doi: 10.1002/anie.201507772.
Structure of a TCR-Mimic Antibody with Target Predicts Pharmacogenetics.
Ataie N, Xiang J, Cheng N, Brea EJ, Lu W, Scheinberg DA, Liu C, Ng HL.
J Mol Biol. 2016 Jan 16;428(1):194-205. doi: 10.1016/j.jmb.2015.12.002. Epub 2015
The experimental power of FR900359 to study Gq-regulated biological processes.
Schrage R, Schmitz AL, Gaffal E, Annala S, Kehraus S, Wenzel D, Buellesbach KM, Bald T, Inoue A, Shinjo Y, Galandrin S, Shridhar N, Hesse M, Grundmann M, Merten N, Charpentier TH, Martz M, Butcher AJ, Slodczyk T, Armando S, Effern M, Namkung Y, Jenkins L, Horn V, Stoessel A, Dargatz H, Tietze D, Imhof D, Galés C, Drewke C, Mueller CE, Hoelzel M, Milligan G, Tobin AB, Gomeza J, Dohlman HG, Sondek J, Harden TK, Bouvier M, Laporte SA, Aoki J, Fleischmann BK, Mohr K, Koenig GM, Tueting T, Kostenis E.
Nat Commun. 2015 Dec 14;6:10156. doi: 10.1038/ncomms10156.
The Vps27/Hrs/STAM (VHS) Domain of the Signal-transducing Adaptor Molecule (STAM) Directs Associated Molecule with the SH3 Domain of STAM (AMSH) Specificity to Longer Ubiquitin Chains and Dictates the Position of Cleavage.
Baiady N, Padala P, Mashahreh B, Cohen-Kfir E, Todd EA, Du Pont KE, Berndsen CE, Wiener R.
J Biol Chem. 2016 Jan 22;291(4):2033-42. doi: 10.1074/jbc.M115.689869. Epub 2015
The dipeptide conformations of all twenty amino acid types in the context of biosynthesis.
Bywater RP, Veryazov V.
Springerplus. 2015 Nov 4;4:668.
Light-induced structural changes in a short light, oxygen, voltage (LOV) protein revealed by molecular dynamics simulations-implications for the understanding of LOV photoactivation.
Bocola M, Schwaneberg U, Jaeger KE, Krauss U.
Front Mol Biosci. 2015 Oct 1;2:55. doi: 10.3389/fmolb.2015.00055. eCollection
Qualitative and quantitative pharmacophore-similarity assessment of anthranilamide-based factor Xa inhibitors: applications on similar molecules with identical biological endpoints.
Kumar SP, Rawal RM, Pandya HA, Jasrai YT.
J Recept Signal Transduct Res. 2016;36(2):189-206. doi:
Homology modeling, functional annotation and comparative genomics of outer membrane protein H of Pasteurella multocida.
Ganguly B, Tewari K, Singh R.
J Theor Biol. 2015 Dec 7;386:18-24.
Receptor-Guided De Novo Design of Dengue Envelope Protein Inhibitors.
Desai VH, Kumar SP, Pandya HA, Solanki HA.
Appl Biochem Biotechnol. 2015 Oct;177(4):861-78. doi: 10.1007/s12010-015-1784-y.
Experimental design, modeling and optimization of polyplex formation between DNA oligonucleotides and branched polyethylenimine.
Clima L, Ursu EL, Cojocaru C, Rotaru A, Barboiu M, Pinteala M.
Org Biomol Chem. 2015 Aug 6.
200 Structural insights into the theoretical model of Plasmodium falciparum multi drug resistance 1 protein (PfMDR1) and its interaction with phytochemicals as efficacious antimalarial drugs: an in silico and in vitro approach.
Patel SK, Jha PC, Jasrai Y, Pandya HA, George L.
J Biomol Struct Dyn. 2015;33 Suppl 1:132-4. doi: 10.1080/07391102.2015.1032837.
Prediction of protein targets of kinetin using in silico and in vitro methods: a case study on spinach seed germination mechanism.
Kumar SP, Parmar VR, Jasrai YT, Pandya HA.
J Chem Biol. 2015 May 12;8(3):95-105. doi: 10.1007/s12154-015-0135-3. eCollection
The effect of various atomic partial charge schemes to elucidate consensus activity-correlating molecular regions: a test case of diverse QSAR models.
Kumar SP, Jha PC, Jasrai YT, Pandya HA.
J Biomol Struct Dyn. 2016;34(3):540-59. doi: 10.1080/07391102.2015.1044474. Epub
Computational docking simulations of a DNA-aptamer for argininamide and related ligands.
Albada HB, Golub E, Willner I.
J Comput Aided Mol Des. 2015 Jul;29(7):643-54. doi: 10.1007/s10822-015-9844-5.
Taming molecular flexibility to tackle rare diseases.
Cubellis MV, Baaden M, Andreotti G.
Biochimie. 2015 Jun;113:54-8. doi: 10.1016/j.biochi.2015.03.018. Epub 2015 Apr 2.
JCC Cover New ways to boost molecular dynamics simulations.
Krieger E, Vriend G.
J Comput Chem. 2015 May 15;36(13):996-1007
The open access article is available here, more details about the cover can be found here.
Inter-locus as well as intra-locus heterogeneity in LINE-1 promoter methylation in common human cancers suggests selective demethylation pressure at specific CpGs.
Nuesgen N, Goering W, Dauksa A, Biswas A, Jamil MA, Dimitriou I, Sharma A, Singer H, Fimmers R, Froehlich H, Oldenburg J, Gulbinas A, Schulz WA, El-Maarri O.
Clin Epigenetics. 2015 Mar 1;7(1):17. doi: 10.1186/s13148-015-0051-y. eCollection
Molecular interaction of selected phytochemicals under the charged environment of Plasmodium falciparum chloroquine resistance transporter (PfCRT) model.
Patel SK, Khedkar VM, Jha PC, Jasrai YT, Pandya HA, George LB, Highland HN, Skelton AA.
J Biomol Struct Dyn. 2016;34(2):290-303. doi: 10.1080/07391102.2015.1028449. Epub
Synthesis and evaluation of 2-halogenated-1,1-bis(4-hydroxyphenyl)-2-(3-hydroxyphenyl)-ethylenes as potential estrogen receptor-targeted radiodiagnostic and radiotherapeutic agents.
Hanson RN, Tongcharoensirikul P, Barnsley K, Ondrechen MJ, Hughes A, DeSombre ER.
Steroids. 2015 Apr;96:50-62.
A comprehensive molecular dynamics approach to protein retention modeling in ion exchange chromatography.
Lang KM, Kittelmann J, Durr C, Osberghaus A, Hubbuch J.
J Chromatogr A. 2015 Feb 13;1381:184-93. doi: 10.1016/j.chroma.2015.01.018. Epub
Pocketome of human kinases: prioritizing the ATP binding sites of (yet) untapped protein kinases for drug discovery.
Volkamer A, Eid S, Turk S, Jaeger S, Rippmann F, Fulle S.
J Chem Inf Model. 2015 Mar 23;55(3):538-49. doi: 10.1021/ci500624s. Epub 2015 Jan
Rational Design of Alpha-Helical Antimicrobial Peptides: Do's and Don'ts.
Uggerhoj LE, Poulsen TJ, Munk JK, Fredborg M, Sondergaard TE, Frimodt-Moller N, Hansen PR, Wimmer R.
Chembiochem. 2015 Jan 19;16(2):242-53. doi: 10.1002/cbic.201402581. Epub 2014 Dec
Positioning of cysteine residues within the N-terminal portion of the BST-2/tetherin ectodomain is important for functional dimerization of BST-2.
Welbourn S, Kao S, Du Pont KE, Andrew AJ, Berndsen CE, Strebel K.
J Biol Chem. 2015 Feb 6;290(6):3740-51. doi: 10.1074/jbc.M114.617639. Epub 2014
Novel insights into structure and function of factor XIIIa-inhibitor tridegin.
Boehm M, Baeuml CA, Hardes K, Steinmetzer T, Roeser D, Schaub Y, Than ME, Biswas A, Imhof D.
J Med Chem. 2014 Dec 26;57(24):10355-65. doi: 10.1021/jm501058g. Epub 2014 Dec 5.
Molecular simulation studies of human coagulation factor VIII C domain-mediated membrane binding.
Du J, Wichapong K, Hackeng TM, Nicolaes GA.
Thromb Haemost. 2014 Oct 30;113(2).
A series of PDB-related databanks for everyday needs.
Touw WG, Baakman C, Black J, te Beek TA, Krieger E, Joosten RP, Vriend G.
Nucleic Acids Res. 2015 Jan;43(Database issue):D364-8. doi: 10.1093/nar/gku1028.
Understanding the functional difference between growth arrest-specific protein 6 and protein S: an evolutionary approach.
Studer RA, Opperdoes FR, Nicolaes GA, Mulder AB, Mulder R.
Open Biol. 2014 Oct;4(10). pii: 140121. doi: 10.1098/rsob.140121.
Structural and functional characterization of the R-modules in alginate C-5 epimerases AlgE4 and AlgE6 from Azotobacter vinelandii.
Buchinger E, Knudsen DH, Behrens MA, Pedersen JS, Aarstad OA, Tondervik A, Valla S, Skjak-Braek G, Wimmer R, Aachmann FL.
J Biol Chem. 2014 Nov 7;289(45):31382-96. doi: 10.1074/jbc.M114.567008. Epub 2014
With or without light: comparing the reaction mechanism of dark-operative protochlorophyllide oxidoreductase with the energetic requirements of the light-dependent protochlorophyllide oxidoreductase.
Silva PJ.
PeerJ. 2014 Sep 2;2:e551. doi: 10.7717/peerj.551. eCollection 2014.
NLRP7 inter-domain interactions: the NACHT-associated domain is the physical mediator for oligomeric assembly.
Singer H, Biswas A, Zimmer N, Messaed C, Oldenburg J, Slim R, El-Maarri O.
Mol Hum Reprod. 2014 Oct;20(10):990-1001. doi: 10.1093/molehr/gau060. Epub 2014
Structural features of peptoid-peptide hybrids in lipid-water interfaces.
Uggerhoj LE, Munk JK, Hansen PR, Guentert P, Wimmer R.
FEBS Lett. 2014 Aug 25;588(17):3291-7. doi: 10.1016/j.febslet.2014.07.016. Epub
A cell-permeable inhibitor to trap g-alpha-q proteins in the empty pocket conformation.
Schmitz AL, Schrage R, Gaffal E, Charpentier TH, Wiest J, Hiltensperger G, Morschel J, Hennen S, Haeussler D, Horn V, Wenzel D, Grundmann M, Buellesbach KM, Schroeder R, Brewitz HH, Schmidt J, Gomeza J, Gales C, Fleischmann BK, Tueting T, Imhof D, Tietze D, Guetschow M, Holzgrabe U, Sondek J, Harden TK, Mohr K, Kostenis E.
Chem Biol. 2014 Jul 17;21(7):890-902. doi: 10.1016/j.chembiol.2014.06.003.
Refined Mapping of a Hypertension Susceptibility Locus on Rat Chromosome 12.
Prisco SZ, Prokop JW, Sarkis AB, Yeo NC, Hoffman MJ, Hansen CC, Jacob HJ, Flister MJ, Lazar J.
Hypertension. 2014 Jul 7. pii: HYPERTENSIONAHA.114.03550.
Computational development of rubromycin-based lead compounds for HIV-1 reverse transcriptase inhibition
Bernardo CEP, Silva PJ
PeerJ 2014 2:e470
YASARA View - molecular graphics for all devices - from smartphones to workstations.
Krieger E, Vriend G.
Bioinformatics. 2014 Oct 15;30(20):2981-2. doi: 10.1093/bioinformatics/btu426.
Computational library design for increasing haloalkane dehalogenase stability.
Floor RJ, Wijma HJ, Colpa DI, Ramos-Silva A, Jekel PA, Szymański W, Feringa BL, Marrink SJ, Janssen DB.
Chembiochem. 2014 Jul 21;15(11):1660-72. doi: 10.1002/cbic.201402128. Epub 2014
The Arg98Trp mutation in human VKORC1 causing VKCFD2 disrupts a di-arginine-based ER retention motif.
Czogalla KJ, Biswas A, Rost S, Watzka M, Oldenburg J.
Blood. 2014 Aug 21;124(8):1354-62. doi: 10.1182/blood-2013-12-545988. Epub 2014
Novel kv7.1-phosphatidylinositol 4,5-bisphosphate interaction sites uncovered by charge neutralization scanning.
Eckey K, Wrobel E, Strutz-Seebohm N, Pott L, Schmitt N, Seebohm G.
J Biol Chem. 2014 Aug 15;289(33):22749-58. doi: 10.1074/jbc.M114.589796.
Computationally efficient and accurate enantioselectivity modeling by clusters of molecular dynamics simulations.
Wijma HJ, Marrink SJ, Janssen DB.
J Chem Inf Model. 2014 Jul 28;54(7):2079-92. doi: 10.1021/ci500126x. Epub 2014
Eight novel F13A1 gene missense mutations in patients with mild FXIII deficiency: in silico analysis suggests changes in FXIII-A subunit structure/function.
Biswas A, Ivaskevicius V, Thomas A, Varvenne M, Brand B, Rott H, Haussels I, Ruehl H, Scholz U, Klamroth R, Oldenburg J.
Ann Hematol. 2014 Oct;93(10):1665-76. doi: 10.1007/s00277-014-2102-4. Epub 2014
Molecular evolution of GPCRs: Melanocortin/melanocortin receptors.
Dores RM, Londraville RL, Prokop J, Davis P, Dewey N, Lesinski N.
J Mol Endocrinol. 2014 Jun;52(3):T29-42. doi: 10.1530/JME-14-0050.
Implementation of pseudoreceptor-based pharmacophore queries in the prediction of probable protein targets: explorations in the protein structural profile of Zea mays.
Kumar SP, Jha PC, Pandya HA, Jasrai YT.
Mol Biosyst. 2014 Jul;10(7):1833-44. doi: 10.1039/c4mb00058g. Epub 2014 Apr 22.
Development of pharmacophore similarity-based quantitative activity hypothesis and its applicability domain: applied on a diverse data-set of HIV-1 integrase inhibitors.
Kumar SP, Jasrai YT, Mehta VP, Pandya HA.
J Biomol Struct Dyn. 2015;33(4):706-22. doi: 10.1080/07391102.2014.908142. Epub
Discovery of the elusive leptin in birds: identification of several 'missing links' in the evolution of leptin and its receptor.
Prokop JW, Schmidt C, Gasper D, Duff RJ, Milsted A, Ohkubo T, Ball HC, Shawkey MD, Mays HL Jr, Cogburn LA, Londraville RL.
PLoS One. 2014 Mar 24;9(3):e92751. doi: 10.1371/journal.pone.0092751. eCollection
Stabilization of cyclohexanone monooxygenase by a computationally designed disulfide bond spanning only one residue.
van Beek HL, Wijma HJ, Fromont L, Janssen DB, Fraaije MW.
FEBS Open Bio. 2014 Feb 3;4:168-74. doi: 10.1016/j.fob.2014.01.009. eCollection
The lantibiotic NAI-107 binds to bactoprenol-bound cell wall precursors and impairs membrane functions.
Muench D, Mueller A, Schneider T, Kohl B, Wenzel M, Bandow JE, Maffioli S, Sosio M, Donadio S, Wimmer R, Sahl HG.
J Biol Chem. 2014 Apr 25;289(17):12063-76. doi: 10.1074/jbc.M113.537449. Epub
A computational model for non-conserved mature miRNAs from the rice genome.
Kumar SP, Pandya HA, Jasrai YT.
SAR QSAR Environ Res. 2014;25(3):205-20. doi: 10.1080/1062936X.2013.875941. Epub
Compound prioritization from inverse docking experiment using receptor-centric and ligand-centric methods: a case study on Plasmodium falciparum Fab enzymes.
Kumar SP, Pandya HA, Desai VH, Jasrai YT.
J Mol Recognit. 2014 Apr;27(4):215-29. doi: 10.1002/jmr.2353.
LIMD2 is a small LIM-only protein overexpressed in metastatic lesions that regulates cell motility and tumor progression by directly binding to and activating the integrin-linked kinase.
Peng H, Talebzadeh-Farrooji M, Osborne MJ, Prokop JW, McDonald PC, Karar J, Hou Z, He M, Kebebew E, Orntoft T, Herlyn M, Caton AJ, Fredericks W, Malkowicz B, Paterno CS, Carolin AS, Speicher DW, Skordalakes E, Huang Q, Dedhar S, Borden KL, Rauscher FJ 3rd.
Cancer Res. 2014 Mar 1;74(5):1390-403. doi: 10.1158/0008-5472.CAN-13-1275.
Structural and functional insights into the catalytic inactivity of the major fraction of buffalo milk xanthine oxidoreductase.
Gadave KS, Panda S, Singh S, Kalra S, Malakar D, Mohanty AK, Kaushik JK.
PLoS One. 2014 Jan 31;9(1):e87618
Blocking CD40-TRAF6 signaling is a therapeutic target in obesity-associated insulin resistance.
Chatzigeorgiou A, Seijkens T, Zarzycka B, Engel D, Poggi M, van den Berg S, van den Berg S, Soehnlein O, Winkels H, Beckers L, Lievens D, Driessen A, Kusters P, Biessen E, Garcia-Martin R, Klotzsche-von Ameln A, Gijbels M, Noelle R, Boon L, Hackeng T, Schulte KM, Xu A, Vriend G, Nabuurs S, Chung KJ, Willems van Dijk K, Rensen PC, Gerdes N, de Winther M, Block NL, Schally AV, Weber C, Bornstein SR, Nicolaes G, Chavakis T, Lutgens E.
Proc Natl Acad Sci U S A. 2014 Feb 18;111(7):2686-91. doi:
Computationally designed libraries for rapid enzyme stabilization.
Wijma HJ, Floor RJ, Jekel PA, Baker D, Marrink SJ, Janssen DB.
Protein Eng Des Sel. 2014 Feb;27(2):49-58. doi: 10.1093/protein/gzt061. Epub 2014
Structural basis of PI(4,5)P2-dependent regulation of GluA1 by phosphatidylinositol-5-phosphate 4-kinase, type II, alpha (PIP5K2A).
Seebohm G, Wrobel E, Pusch M, Dicks M, Terhag J, Matschke V, Rothenberg I, Ursu ON, Hertel F, Pott L, Lang F, Schulze-Bahr E, Hollmann M, Stoll R, Strutz-Seebohm N.
Pflugers Arch. 2014 Jan 5.
Genetic variation in the two-pore domain potassium channel, TASK-1, may contribute to an atrial substrate for arrhythmogenesis.
Liang B, Soka M, Christensen AH, Olesen MS, Larsen AP, Knop FK, Wang F, Nielsen JB, Andersen MN, Humphreys D, Mann SA, Huttner IG, Vandenberg JI, Svendsen JH, Haunso S, Preiss T, Seebohm G, Olesen SP, Schmitt N, Fatkin D.
J Mol Cell Cardiol. 2014 Feb;67:69-76
The drug diazaborine blocks ribosome biogenesis by inhibiting the AAA-ATPase Drg1.
Loibl M, Klein I, Prattes M, Schmidt C, Kappel L, Zisser G, Gungl A, Krieger E, Pertschy B, Bergler H.
J Biol Chem. 2014 Feb 14;289(7):3913-22. doi: 10.1074/jbc.M113.536110. Epub 2013
A complex partnership: KCNQ1 and KCNE1.
Seebohm G.
Biophys J. 2013 Dec 3;105(11):2437-8.
Severe congenital factor XIII deficiency caused by novel W187X and G273V mutations in the F13A gene; diagnosis and classification according to the ISTH/SSC guidelines.
Souri M, Biswas A, Misawa M, Omura H, Ichinose A.
Haemophilia. 2014 Mar;20(2):255-62
Pharmacophore-similarity-based QSAR (PS-QSAR) for group-specific biological activity predictions.
Prasanth Kumar S, Jasrai YT, Pandya HA, Rawal RM.
J Biomol Struct Dyn. 2015;33(1):56-69. doi: 10.1080/07391102.2013.849618. Epub
Analysis of Sry duplications on the Rattus norvegicus Y-chromosome.
Prokop JW, Underwood AC, Turner ME, Miller N, Pietrzak D, Scott S, Smith C, Milsted A.
BMC Genomics. 2013 Nov 14;14:792. doi: 10.1186/1471-2164-14-792.
Favorable adsorption of capped amino acids on graphene substrate driven by desolvation effect.
Dragneva N, Floriano WB, Stauffer D, Mawhinney RC, Fanchini G, Rubel O.
J Chem Phys. 2013 Nov 7;139(17):174711
Inhibition of CIN85-mediated invasion by a novel SH3 domain binding motif in the lysyl oxidase propeptide.
Sato S, Zhao Y, Imai M, Simister PC, Feller SM, Trackman PC, Kirsch KH, Sonenshein GE.
PLoS One. 2013 Oct 22;8(10):e77288. doi: 10.1371/journal.pone.0077288.
CSF1R mutations in hereditary diffuse leukoencephalopathy with spheroids are loss of function.
Pridans C, Sauter KA, Baer K, Kissel H, Hume DA.
Sci Rep. 2013 Oct 22;3:3013. doi: 10.1038/srep03013.
MAS promoter regulation: a role for Sry and tyrosine nitration of the KRAB domain of ZNF274 as a feedback mechanism.
Prokop JW, Rauscher FJ 3rd, Peng H, Liu Y, Araujo FC, Watanabe I, Reis FM, Milsted A.
Clin Sci (Lond). 2014 May;126(10):727-38. doi: 10.1042/CS20130385.
Design and evaluation of xanthine based adenosine receptor antagonists: potential hypoxia targeted immunotherapies.
Thomas R, Lee J, Chevalier V, Sadler S, Selesniemi K, Hatfield S, Sitkovsky M, Ondrechen MJ, Jones GB.
Bioorg Med Chem. 2013 Dec 1;21(23):7453-64.
Engineering and kinetic stabilization of the therapeutic enzyme Anabeana variabilis phenylalanine ammonia lyase.
Jaliani HZ, Farajnia S, Mohammadi SA, Barzegar A, Talebi S.
Appl Biochem Biotechnol. 2013 Dec;171(7):1805-18
Human VKORC1 mutations cause variable degrees of 4-hydroxycoumarin resistance and affect putative warfarin binding interfaces.
Czogalla KJ, Biswas A, Wendeln AC, Westhofen P, Mueller CR, Watzka M, Oldenburg J.
Blood. 2013 Oct 10;122(15):2743-50
The preferred conformation of dipeptides in the context of biosynthesis.
Bywater RP, Veryazov V.
Naturwissenschaften. 2013 Sep;100(9):853-9
The linker pivot in Ci-VSP: the key to unlock catalysis.
Hobiger K, Utesch T, Mroginski MA, Seebohm G, Friedrich T.
PLoS One. 2013 Jul 29;8(7):e70272
The good, the bad and the dubious: VHELIBS, a validation helper for ligands and binding sites.
Cereto-Massague A, Ojeda MJ, Joosten RP, Valls C, Mulero M, Salvado MJ, Arola-Arnal A, Arola L, Garcia-Vallve S, Pujadas G.
J Cheminform. 2013 Jul 29;5(1):36
Unraveling the photoluminescence response of light-switching ruthenium(II) complexes bound to amyloid-beta.
Cook NP, Ozbil M, Katsampes C, Prabhakar R, Marti AA.
J Am Chem Soc. 2013 Jul 24;135(29):10810-6
A common structural component for beta-subunit mediated modulation of slow inactivation in different KV channels.
Strutz-Seebohm N, Henrion U, Schmitt N, Schulze-Bahr E, Seebohm G.
Cell Physiol Biochem. 2013;31(6):968-80
Redesign of a Phenylalanine Aminomutase into a Phenylalanine Ammonia Lyase
Bartsch S, Wybenga GG, Jansen M, Heberling MM, Wu B, Dijkstra BW, Janssen DB
ChemCatChem 5,1797-1802
A plant homolog of animal glutamate receptors is an ion channel gated by multiple hydrophobic amino acids.
Tapken D, Anschuetz U, Liu LH, Huelsken T, Seebohm G, Becker D, Hollmann M.
Sci Signal. 2013 Jun 11;6(279):ra47
Differential mechanisms of activation of the Ang peptide receptors AT1, AT2, and MAS: using in silico techniques to differentiate the three receptors.
Prokop JW, Santos RA, Milsted A.
PLoS One. 2013 Jun 3;8(6):e65307. doi: 10.1371/journal.pone.0065307. Print 2013.
A method for in silico identification of SNAIL/SLUG DNA binding potentials to the E-box sequence using molecular dynamics and evolutionary conserved amino acids.
Prokop JW, Liu Y, Milsted A, Peng H, Rauscher FJ 3rd.
J Mol Model. 2013 Sep;19(9):3463-9. doi: 10.1007/s00894-013-1876-y. Epub 2013 May
Structural insights into the theoretical model of Plasmodium falciparum NADH dehydrogenase and its interaction with artemisinin and derivatives: towards global health therapeutics.
Kumar SP, Jasrai YT, Pandya HA, George LB, Patel SK.
OMICS. 2013 May;17(5):231-41. doi: 10.1089/omi.2012.0129.
Soluble polysialylated NCAM: a novel player of the innate immune system in the lung.
Ulm C, Saffarzadeh M, Mahavadi P, Mueller S, Prem G, Saboor F, Simon P, Middendorff R, Geyer H, Henneke I, Bayer N, Rinne S, Luetteke T, Boettcher-Friebertshaeuser E, Gerardy-Schahn R, Schwarzer D, Muehlenhoff M, Preissner KT, Guenther A, Geyer R, Galuska SP.
Cell Mol Life Sci. 2013 Oct;70(19):3695-708. doi: 10.1007/s00018-013-1342-0. Epub
Insights into pathological mechanisms of missense mutations in C-Terminal domains of von Willebrand factor causing qualitative or quantitative von Willebrand disease
Yadegari H, Driesen J, Pavlova A, Biswas A, Ivaskevicius V, Klamroth R, Oldenburg J
Haematologica. 2013 Mar 28
A conserved threonine in the S1-S2 loop of K(V)7.2 and K (V)7.3 channels regulates voltage-dependent activation.
Fuell Y, Seebohm G, Lerche H, Maljevic S.
Pflugers Arch. 2012 Dec 28.
The size and conservation of a coiled-coil structure in the ectodomain of human BST-2/tetherin is dispensable for inhibition of HIV-1 virion release.
Andrew AJ, Berndsen CE, Kao S, Strebel K.
J Biol Chem. 2012 Dec 28;287(53):44278-88. doi: 10.1074/jbc.M112.418822. Epub
NMR structure of a lytic polysaccharide monooxygenase provides insight into copper binding, protein dynamics, and substrate interactions
Aachmann FL, Sorlie M, Skjak-Braek G, Eijsink VG, Vaaje-Kolstad G
Proc Natl Acad Sci U S A. 2012 Nov 13;109(46):18779-84
An NMR structure determined with the help of YASARA, PDB ID 2LHS
Eurocin, a new fungal defensin: structure, lipid binding, and its mode of action
Oeemig JS, Lynggaard C, Knudsen DH, Hansen FT, Norgaard KD, Schneider T, Vad BS, Sandvang DH, Nielsen LA, Neve S, Kristensen HH, Sahl HG, Otzen DE, Wimmer R
J Biol Chem. 2012 Dec 7;287(50):42361-72
An NMR structure determined with the help of YASARA, PDB ID 2LT8
Leptin and leptin receptor: analysis of a structure to function relationship in interaction and evolution from humans to fish.
Prokop JW, Duff RJ, Ball HC, Copeland DL, Londraville RL.
Peptides. 2012 Dec;38(2):326-36. doi: 10.1016/j.peptides.2012.10.002. Epub 2012
Effects of non-catalytic, distal amino acid residues on activity of E. coli DinB (DNA polymerase IV).
Walsh JM, Parasuram R, Rajput PR, Rozners E, Ondrechen MJ, Beuning PJ.
Environ Mol Mutagen. 2012 Dec;53(9):766-76.
Post-translational S-nitrosylation is an endogenous factor fine tuning the properties of human S100A1 protein
LenarcicčZivkovi M, Zareba-Koziol M, Zhukova L, Poznanski J, Zhukov I, Wyslouch-Cieszynska A
J Biol Chem. 2012 Nov 23;287(48):40457-70
An NMR structure determined with the help of YASARA, PDB ID 2LLU
CING: an integrated residue-based structure validation program suite.
Doreleijers JF, Sousa da Silva AW, Krieger E, Nabuurs SB, Spronk CA, Stevens TJ, Vranken WF, Vriend G, Vuister GW.
J Biomol NMR. 2012 Nov;54(3):267-83. doi: 10.1007/s10858-012-9669-7. Epub 2012
Structural rearrangements at physiological pH: nuclear magnetic resonance insights from the V210I human prion protein mutant
Biljan I, Ilc G, Giachin G, Plavec J, Legname G
Biochemistry. 2012 Sep 25;51(38):7465-74
An NMR structure determined with the help of YASARA, PDB ID 2LV1
The human Aurora kinase inhibitor danusertib is a lead compound for anti-trypanosomal drug discovery via target repurposing.
Ochiana SO, Pandarinath V, Wang Z, Kapoor R, Ondrechen MJ, Ruben L, Pollastri MP.
Eur J Med Chem. 2013 Apr;62:777-84.
The KCNE Tango - How KCNE1 Interacts with Kv7.1.
Wrobel E, Tapken D, Seebohm G.
Front Pharmacol. 2012;3:142. Epub 2012 Aug 2.
Protein folding: a problem with multiple solutions.
Bywater RP.
J Biomol Struct Dyn. 2013 Apr;31(4):351-62
Accelerated simulation of unfolding and refolding of a large single chain globular protein.
Seddon GM, Bywater RP.
Open Biol. 2012 Jul;2(7):120087
Inactivation and reactivation of ribonuclease A studied by computer simulation.
Seddon GM, Bywater RP.
Open Biol. 2012 Jul;2(7):120088
NMR structure note: solution structure of Ca2+ binding domain 2B of the third isoform of the Na+/Ca2+ exchanger
Breukels V, Touw WG, Vuister GW
J Biomol NMR. 2012 Sep;54(1):115-21
An NMR structure determined with the help of YASARA, PDB ID 2LT9
Motion of transfer RNA from the A/T state into the A-site using docking and simulations
Caulfield T, Devkota B
Proteins. 2012 Nov;80(11):2489-500
Structural basis for the protective effect of the human prion protein carrying the dominant-negative E219K polymorphism
Biljan I, Giachin G, Ilc G, Zhukov I, Plavec J, Legname G
Biochem J. 2012 Sep 1;446(2):243-51
An NMR structure determined with the help of YASARA, PDB IDs 2LFT and 2LSB
POOL server: machine learning application for functional site prediction in proteins.
Somarowthu S, Ondrechen MJ.
Bioinformatics. 2012 Aug 1;28(15):2078-9.
The Catalytic Machinery of Rhomboid Proteases: Combined MD and QM Simulation
Uritsky N, Shokhen M, Albeck A
J Chem Theory Comput
Overlapping cardiac phenotype associated with a familial mutation in the voltagesensor of the KCNQ1 channel.
Henrion U, Zumhagen S, Steinke K, Strutz-Seebohm N, Stallmeyer B, Lang F, Schulze-Bahr E, Seebohm G.
Cell Physiol Biochem. 2012;29(5-6):809-18. Epub 2012 May
Amino acid function and docking site prediction through combining disease variants, structure alignments, sequence alignments, and molecular dynamics: a study of the HMG domain.
Prokop JW, Leeper TC, Duan ZH, Milsted A.
BMC Bioinformatics. 2012 Mar 13;13 Suppl 2:S3. doi: 10.1186/1471-2105-13-S2-S3.
X-ray structures of the progesterone receptor ligand-binding domain in its agonist state reveal differing mechanisms for the mixed profiles of 11b-substituted steroids
Lusher SJ, Raaijmakers HC, Vu Pham D, Kazemier B, Bosch R, McGuire R, Azevedo R, Dechering K, Oubrie A, van Duin M, de Vlieg J
J Biol Chem. 2012 Apr 25
PDB_REDO: constructive validation, more than just looking for errors
Joosten RP, Joosten K, Murshudov GN, Perrakis A
Acta Crystallogr D Biol Crystallogr. 2012 Apr;68(Pt 4):484-96
Highly perturbed pKa values in the unfolded state of hen egg white lysozyme
Bradley J, O'Meara F, Farrell D, Nielsen JE
Biophys J. 2012 Apr 4;102(7):1636-45
Identification of a novel signaling pathway and its relevance for GluA1 recycling.
Seebohm G, Neumann S, Theiss C, Novkovic T, Hill EV, Tavare JM, Lang F, Hollmann M, Manahan-Vaughan D, Strutz-Seebohm N.
PLoS One. 2012;7(3):e33889. Epub 2012 Mar 21.
Novel Mutation in Spectrin-like Repeat 1 of Dystrophin Central Domain Causes Protein Misfolding and Mild Becker Muscular Dystrophy
Acsadi G, Moore SA, Cheron A, Delalande O, Bennett L, Kupsky W, El-Baba M, Le Rumeur E, Hubert JF
J Biol Chem. 2012 May 25;287(22):18153-62
Structurally diverse y-conotoxin PIIIA isomers block sodium channel NaV 1.4
Tietze AA, Tietze D, Ohlenschlaeger O, Leipold E, Ullrich F, Kuehl T, Mischo A, Buntkowsky G, Goerlach M, Heinemann SH, Imhof D
Angew Chem Int Ed Engl. 2012 Apr 23;51(17):4058-61
Goodpasture antigen-binding protein/ceramide transporter binds to human serum amyloid P-component and is present in brain amyloid plaques.
Mencarelli C, Bode GH, Losen M, Kulharia M, Molenaar PC, Veerhuis R, Steinbusch HW, De Baets MH, Nicolaes GA, Martinez-Martinez P.
J Biol Chem. 2012 Apr 27;287(18):14897-911. doi: 10.1074/jbc.M111.299545. Epub
Evolution of the voltage sensor domain of the voltage-sensitive phosphoinositide phosphatase, VSP/TPTE, suggests a role as a proton channel in eutherian mammals
Sutton KA, Jungnickel MK, Jovine L, Florman HM.
Mol Biol Evol. 2012 Mar 6
On dating stages in prebiotic chemical evolution.
Bywater RP.
Naturwissenschaften. 2012 Mar;99(3):167-76
The insect defensin lucifensin from Lucilia sericata
Nygaard MK, Andersen AS, Kristensen HH, Krogfelt KA, Fojan P, Wimmer R
J Biomol NMR. 2012 Mar;52(3):277-82
An NMR structure determined with the help of YASARA, PDB ID 2LLD
From rat to human: regulation of Renin-Angiotensin system genes by sry.
Prokop JW, Watanabe IK, Turner ME, Underwood AC, Martins AS, Milsted A.
Int J Hypertens. 2012;2012:724240. doi: 10.1155/2012/724240. Epub 2012 Jan 22.
Directed evolution strategies for enantiocomplementary haloalkane dehalogenases: from chemical waste to enantiopure building blocks
van Leeuwen JG, Wijma HJ, Floor RJ, van der Laan JM, Janssen DB
Chembiochem. 2012 Jan 2;13(1):137-48
Mixed inhibition of adenosine deaminase activity by 1,3-dinitrobenzene: a model for understanding cell-selective neurotoxicity in chemically-induced energy deprivation syndromes in brain
Wang Y, Liu X, Schneider B, Zverina EA, Russ K, Wijeyesakere SJ, Fierke CA, Richardson RJ, Philbert MA
Toxicol Sci. 2012 Feb;125(2):509-21
Pharmacological validation of Trypanosoma brucei phosphodiesterases B1 and B2 as druggable targets for African sleeping sickness.
Bland ND, Wang C, Tallman C, Gustafson AE, Wang Z, Ashton TD, Ochiana SO, McAllister G, Cotter K, Fang AP, Gechijian L, Garceau N, Gangurde R, Ortenberg R, Ondrechen MJ, Campbell RK, Pollastri MP.
J Med Chem. 2011 Dec 8;54(23):8188-94..
Altered stress stimulation of inward rectifier potassium channels in Andersen-Tawil syndrome.
Seebohm G, Strutz-Seebohm N, Ursu ON, Preisig-Mueller R, Zuzarte M, Hill EV,Kienitz MC, Bendahhou S, Fauler M, Tapken D, Decher N, Collins A, Jurkat-Rott K,Steinmeyer K, Lehmann-Horn F, Daut J, Tavare JM, Pott L, Bloch W, Lang F.
FASEB J. 2012 Feb;26(2):513-22. Epub 2011 Oct 14.
Homology modeling and functional annotation of bubaline pregnancy associated glycoprotein 2
Ganguly B and Prasad S
Journal of Animal Science and Biotechnology 2012, 3:13
Molecular Docking of Aromatase Inhibitors
Suvannang N, Nantasenamat C, Isarankura-Na-Ayudhya C, Prachayasittikul V
Molecules 2011, 16(5):3597-3617
A tale of two isomerases: compact versus extended active sites in ketosteroid isomerase and phosphoglucose isomerase.
Somarowthu S, Brodkin HR, D'Aquino JA, Ringe D, Ondrechen MJ, Beuning PJ.
Biochemistry. 2011 Nov 1;50(43):9283-95.
Enzyme closure and nucleotide binding structurally lock guanylate kinase
Delalande O, Sacquin-Mora S, Baaden M
Biophys J. 2011 Sep 21;101(6):1440-9
Plasmin substrate binding site cooperativity guides the design of potent peptide aldehyde inhibitors
Swedberg JE, Harris JM
Biochemistry. 2011 Oct 4;50(39):8454-62
Structural basis for agonism and antagonism for a set of chemically related progesterone receptor modulators
Lusher SJ, Raaijmakers HC, Vu-Pham D, Dechering K, Lam TW, Brown AR, Hamilton NM, Nimz O, Bosch R, McGuire R, Oubrie A, de Vlieg J
J Biol Chem. 2011 Oct 7;286(40):35079-86
Toward the molecular basis of inherited prion diseases: NMR structure of the human prion protein with V210I mutation
Biljan I, Ilc G, Giachin G, Raspadori A, Zhukov I, Plavec J, Legname G
J Mol Biol. 2011 Sep 30;412(4):660-73
An NMR structure determined with the help of YASARA, PDB ID 2LEJ
Structural basis of slow activation gating in the cardiac I Ks channel complex.
Strutz-Seebohm N, Pusch M, Wolf S, Stoll R, Tapken D, Gerwert K, Attali B,Seebohm G.
Cell Physiol Biochem. 2011;27(5):443-52. Epub 2011 Jun
Molecular Docking of Aromatase Inhibitors
Suvannang N, Nantasenamat C, Isarankura-Na-Ayudhya C, Prachayasittikul V
Molecules 2011, 16(5), 3597-3617
Mastering the canonical loop of serine protease inhibitors: enhancing potency by optimising the internal hydrogen bond network
Swedberg JE, de Veer SJ, Sit KC, Reboul CF, Buckle AM, Harris JM
PLoS One. 2011 Apr 27;6(4):e19302
How to remain nonfolded and pliable: the linkers in modular alpha-amylases as a case study.
Feller G, Dehareng D, Lage JL
FEBS J. 2011 Jul;278(13):2333-40
Inhibition of Kir2.1 (KCNJ2) by the AMP-activated protein kinase.
Alesutan I, Munoz C, Sopjani M, Dermaku-Sopjani M, Michael D, Fraser S, Kemp BE, Seebohm G, Foeller M, Lang F.
Biochem Biophys Res Commun. 2011 May 20;408(4):505-10
Aminoacyl-coenzyme A synthesis catalyzed by a CoA ligase from Penicillium chrysogenum
Koetsier MJ, Jekel PA, Wijma HJ, Bovenberg RA, Janssen DB
FEBS Lett. 2011 Mar 23;585(6):893-8
Computational characterization of the substrate-binding mode in coproporphyrinogen III oxidase
Silva PJ, Ramos MJ
J Phys Chem B. 2011 Mar 3;115(8):1903-10
Enantioselective CuII-Catalyzed Diels-Alder and Michael Addition Reactions in Water Using Bio-Inspired Triazacyclophane-Based Ligands
Bauke Albada H, Rosati F, Coquiere D, Roelfes G, Liskamp RM
Eur J Org Chem 2011:1714-1720
The Molecular Basis of Sex: Linking Yeast to Human
Swanson WJ, Aagaard JE, Vacquier VD, Monne M, Al Hosseini HS, Jovine L
Mol Biol Evol. 2011 Jan 31
Kinetic Resolution of alpha-Bromoamides: Experimental and Theoretical Investigation of Highly Enantioselective Reactions Catalyzed by Haloalkane Dehalogenases
Westerbeek, A Szymanski, W Wijma, HJ, Marrink, SJ, Feringa, BL, Janssen, DB
Adv. Synth. Catal. 353, 931-944
High-performance prediction of functional residues in proteins with machine learning and computed input features.
Somarowthu S, Yang H, Hildebrand DG, Ondrechen MJ.
Biopolymers. 2011 Jun;95(6):390-400.
Structure-Function Relationship of Cytoplasmic and Nuclear IkB Proteins: An In Silico Analysis
Manavalan B, Basith S, Choi YM, Lee G, Choi S
PLoS One. 2010 Dec 23;5(12):e15782
A series of PDB related databases for everyday needs
Joosten RP, te Beek TA, Krieger E, Hekkelman ML, Hooft RW, Schneider R, Sander C, Vriend G
Nucleic Acids Res. 2011 Jan;39(Database issue):D411-9
Modulation of human ether a gogo related channels by CASQ2 contributes to etiology of catecholaminergic polymorphic ventricular tachycardia (CPVT).
Eckey K, Strutz-Seebohm N, Katz G, Fuhrmann G, Henrion U, Pott L, Linke WA, Arad M, Lang F, Seebohm G.
Cell Physiol Biochem. 2010;26(4-5):503-12. Epub 2010 Oct
HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?
Santos PC, Pereira AC, Cancado RD, Schettert IT, Sobreira TJ, Oliveira PS, Hirata RD, Hirata MH, Figueiredo MS, Chiattone CS, Krieger JE, Guerra-Shinohara EM
Blood Cells Mol Dis. 2010 Dec 15;45(4):302-7
DFG-in and DFG-out homology models of TrkB kinase receptor: Induced-fit and ensemble docking
Podlipnik C, Tutino F, Bernardi A, Seneci P
J Mol Graph Model. 2010 Oct 7
Insights into Egg Coat Assembly and Egg-Sperm Interaction from the X-Ray Structure of Full-Length ZP3
Han L, Monne M, Okumura H, Schwend T, Cherry AL, Flot D, Matsuda T, Jovine L
Cell. 2010 Oct 20
Residues at the tip of the pore loop of NR3B-containing NMDA receptors determine Ca2+ permeability and Mg2+ block.
Cavara NA, Orth A, Hicking G, Seebohm G, Hollmann M.
BMC Neurosci. 2010 Oct 19;11:133.
Engineering of an enantioselective tyrosine aminomutase by mutation of a single active site residue in phenylalanine aminomutase
Wu B, Szymański W, Wijma HJ, Crismaru CG, de Wildeman S, Poelarends GJ, Feringa BL, Janssen DB
Chem Commun (Camb). 2010 Nov 21;46(43):8157-9
Two-dimensional heteronuclear saturation transfer difference NMR reveals detailed integrin avb6 protein-peptide interactions
Wagstaff JL, Vallath S, Marshall JF, Williamson RA, Howard MJ
Chem Commun (Camb). 2010 Oct 28;46(40):7533-5
NMR structure of the human prion protein with the pathological Q212P mutation reveals unique structural features
Ilc G, Giachin G, Jaremko M, Jaremko L, Benetti F, Plavec J, Zhukov I, Legname G
PLoS One. 2010 Jul 22;5(7):e11715
The {alpha}-galactosidase type A gene aglA from Aspergillus niger encodes a fully functional {alpha}-N-acetylgalactosaminidase
Kulik N, Weignerova L, Filipi T, Pompach P, Novak P, Mrazek H, Slamova K, Bezouska K, Kren V, Ettrich R
Glycobiology. 2010 Nov;20(11):1410-9
In silico prediction of the 3D structure of trimeric asialoglycoprotein receptor bound to triantennary oligosaccharide
Ramadugu SK, Chung YH, Fuentes EJ, Rice KG, Margulis CJ
J Am Chem Soc. 2010 Jul 7;132(26):9087-95
Monte Carlo-based rigid body modelling of large protein complexes against small angle scattering data
Meesters C, Pairet B, Rabenhorst A, Decker H, Jaenicke E
Comput Biol Chem. 2010 Jun;34(3):158-64
A Tale of Two Acids: When Arginine Is a More Appropriate Acid than H(3)O(+)
Silva PJ, Schulz C, Jahn D, Jahn M, Ramos MJ
J Phys Chem B. 2010 Jun 16
Systematic structure-function analysis of androgen receptor Leu701 mutants explains the properties of the prostate cancer mutant L701H
van de Wijngaart DJ, Molier M, Lusher SJ, Hersmus R, Jenster G, Trapman J, Dubbink HJ
J Biol Chem. 2010 Feb 12;285(7):5097-105
Factor VIII-eGFP fusion proteins with preserved functional activity for the analysis of the early secretory pathway of factor VIII.
Heinz S, Schuettrumpf J, Simpson JC, Pepperkok R, Nicolaes GA, Abriss D, Milanov P, Roth S, Seifried E, Tonn T.
Thromb Haemost. 2009 Nov;102(5):925-35. doi: 10.1160/TH08-12-0807.
Homology modelling and spectroscopy, a never-ending love story
Venselaar H, Joosten RP, Vroling B, Baakman CA, Hekkelman ML, Krieger E, Vriend G
Eur Biophys J. 2010 Mar;39(4):551-63
Molecular dynamics analysis of the wild type and dF508 mutant structures of the human CFTR-nucleotide binding domain 1
Bisignano P, Moran O
Biochimie. 2010 Jan;92(1):51-57
Folding defects in P-type ATP 8B1 associated with hereditary cholestasis are ameliorated by 4-phenylbutyrate
van der Velden LM, Stapelbroek JM, Krieger E, van den Berghe PV, Berger R, Verhulst PM, Holthuis JC, Houwen RH, Klomp LW, van de Graaf SF
Hepatology. 2010 Jan;51(1):286-96
CASP8 Special issueImproving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8
Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K
Proteins. 2009;77 Suppl 9:114-22
The journal cover shows how the knowledge-based potentials in the YASARA force field cover the various dihedral angles of an arginine residue.
PDB_REDOPDB_REDO: automated re-refinement of X-ray structure models in the PDB
Joosten RP, Salzemann J, Bloch V, Stockinger H, Berglund AC, Blanchet C, Bongcam-Rudloff E, Combet C, Da Costa AL, Deleage G, Diarena M, Fabbretti R, Fettahi G, Flegel V, Gisel A, Kasam V, Kervinen T, Korpelainen E, Mattila K, Pagni M, Reichstadt M, Breton V, Tickle IJ and Vriend G
J. Appl. Cryst. (2009). 42, 376-384
Journal cover made with YASARA.
Challenging a paradigm: theoretical calculations of the protonation state of the Cys25-His159 catalytic diad in free papain
Shokhen M, Khazanov N, Albeck A.
Proteins. 2009 Dec;77(4):916-26
Reduced expression of ATP7B affected by Wilson disease-causing mutations is rescued by pharmacological folding chaperones 4-phenylbutyrate and curcumin
van den Berghe PV, Stapelbroek JM, Krieger E, de Bie P, van de Graaf SF, de Groot RE, van Beurden E, Spijker E, Houwen RH, Berger R, Klomp LW
Hepatology. 2009 Dec;50(6):1783-95
Antibacterial activity of six novel peptides from Tityus discrepans scorpion venom. A fluorescent probe study of microbial membrane Na+ permeability changes
Diaz P, D'Suze G, Salazar V, Sevcik C, Shannon JD, Sherman NE, Fox JW.
Toxicon. 2009 Nov;54(6):802-17
Proteome-wide substrate analysis indicates substrate exclusion as a mechanism to generate caspase-7 versus caspase-3 specificity
Demon D, Van Damme P, Vanden Berghe T, Deceuninck A, Van Durme J, Verspurten J, Helsens K, Impens F, Wejda M, Schymkowitz J, Rousseau F, Madder A, Vandekerckhove J, Declercq W, Gevaert K, Vandenabeele P
Mol Cell Proteomics. 2009 Sep 16
Homology modelling and spectroscopy, a never-ending love story
Venselaar H, Joosten RP, Vroling B, Baakman CA, Hekkelman ML, Krieger E, Vriend G
Eur Biophys J. 2009 Aug 29
Molecular Dynamics Analysis Of The Wild Type And dF508 Mutant Structures Of The Human CFTR-Nucleotide Binding Domain 1
Bisignano P and Moran O
Biochemie (2009) in press
BBA cover Structural organization of WrbA in apo- and holoprotein crystals
Wolfova J, Smatanova IK, Brynda J, Mesters JR, Lapkouski M, Kuty M, Natalello A, Chatterjee N, Chern SY, Ebbel E, Ricci A, Grandori R, Ettrich R, Carey J
Biochim Biophys Acta. 2009 Sep;1794(9):1288-98 Journal cover made with YASARA:
Structure cover Protein-peptide interactions adopt the same structural motifs as monomeric protein folds
Vanhee P, Stricher F, Baeten L, Verschueren E, Lenaerts T, Serrano L, Rousseau F, Schymkowitz J
Structure. 2009 Aug 12;17(8):1128-36 Journal cover made with YASARA:
Accurate prediction of DnaK-peptide binding via homology modelling and experimental data
Van Durme J, Maurer-Stroh S, Gallardo R, Wilkinson H, Rousseau F, Schymkowitz J
PLoS Comput Biol. 2009 Aug;5(8):e1000475
Long QT syndrome-associated mutations in the voltage sensor of I(Ks) channels.
Henrion U, Strutz-Seebohm N, Duszenko M, Lang F, Seebohm G.
Cell Physiol Biochem. 2009;24(1-2):11-6. Epub 2009 Jul 1.
Structure of the tyrosine-sulfated C5a receptor N terminus in complex with chemotaxis inhibitory protein of Staphylococcus aureus
Ippel JH, de Haas CJ, Bunschoten A, van Strijp JA, Kruijtzer JA, Liskamp RM, Kemmink J
J Biol Chem. 2009 May 1;284(18):12363-72
Mapping the sequence mutations of the 2009 H1N1 influenza A virus neuraminidase relative to drug and antibody binding sites
Maurer-Stroh S, Ma J, Lee RT, Sirota FL, Eisenhaber F
Biol Direct. 2009 May 20;4(1):18
Structure of the tyrosine-sulfated C5a receptor N terminus in complex with chemotaxis inhibitory protein of Staphylococcus aureus
Ippel JH, de Haas CJ, Bunschoten A, van Strijp JA, Kruijtzer JA, Liskamp RM, Kemmink J
J Biol Chem. 2009 May 1;284(18):12363-72
An NMR structure determined with the help of YASARA, PDB ID 2K3U
Protein sequences encode safeguards against aggregation
Reumers J, Maurer-Stroh S, Schymkowitz J, Rousseau F
Hum Mutat. 2009 Mar;30(3):431-7
A single residue influences the reaction mechanism of ammonia lyases and mutases
Bartsch S and Bornscheuer UT
Angew Chem Int Ed Engl. 2009;48(18):3362-5
Brominated phenols as auxin-like molecules
Spaepena S, Van Durme J, Dasa F, Maurer-Stroh S, Rousseau F, Schymkowitzb J and Vanderleydena J
Europ. J. of Soil Biol. 2009;45:81-87
Functional Role of Arginine 375 in Transmembrane Helix 6 of Multidrug Resistance Protein 4 (MRP4/ABCC4)
El-Sheikh AA, van den Heuvel JJ, Krieger E, Russel FG, Koenderink JB
Mol Pharmacol. 2008 Oct;74(4):964-71
Differential blocking effects of the acetaldehyde-derived DNA lesion N2-ethyl-2'-deoxyguanosine on transcription by multisubunit and single subunit RNA polymerases
Cheng TF, Hu X, Gnatt A, Brooks PJ
J Biol Chem. 2008 Oct 10;283(41):27820-8
Structural characterization of the alpha-hemolysin monomer from Staphylococcus aureus
Meesters C, Brack A, Hellmann N, Decker H
Proteins. 2008 Sep 17;75(1):118-126
The crystal structure of the platelet activator aggretin reveals a novel (alphabeta)2 dimeric structure
Hooley E, Papagrigoriou E, Navdaev A, Pandey AV, Clemetson JM, Clemetson KJ, Emsley J
Biochemistry. 2008 Jul 29;47(30):7831-7
A Software Library for Monte Carlo-Based Rigid Body Modelling Against Small Angle Scattering Data
Meesters C
From Computational Biophysics to Systems Biology (CBSB08) NIC Series, Vol. 40
Identification of surface epitopes of human coagulation factor Va which are important for interaction with activated protein C and heparin
Segers K, Dahlback B, Rosing J, Nicolaes GA
J Biol Chem. 2008 Jun 2
Complete inversion of enantioselectivity towards acetylated tertiary alcohols by a double mutant of a Bacillus subtilis esterase
Bartsch S, Kourist R, Bornscheuer UT
Angew Chem Int Ed Engl. 2008;47(8):1508-11
Cover Hepcidin: from discovery to differential diagnosis
Kemna EHJM, Tjalsma H, Willems HL, Swinkels DW
Haematologica, 93(1):90-97. Journal cover made with YASARA:
A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations
Schweikardt T, Olivares C, Solano F, Jaenicke E, Garcia-Borron JC, Decker H
Pigment Cell Res. 2007 Oct;20(5):394-401
MYO15A (DFNB3) mutations in Turkish hearing loss families and functional modeling of a novel motor domain mutation
Kalay E, Uzumcu A, Krieger E, Caylan R, Uyguner O, Ulubil-Emiroglu M, Erdol H, Kayserili H, Hafiz G, Baserer N, Heister AJ, Hennies HC, Nurnberg P, Basaran S, Brunner HG, Cremers CW, Karaguzel A, Wollnik B, Kremer H
Am J Med Genet A. 2007 Oct 15;143(20):2382-9
Structural diversity in twin-arginine signal peptide-binding proteins
Maillard J, Spronk CA, Buchanan G, Lyall V, Richardson DJ, Palmer T, Vuister GW, Sargent F
Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15641-6
An NMR structure determined with the help of YASARA, PDB ID 2JSX
Screening of the active site from water by the incoming ligand triggers catalysis and inhibition in serine proteases
Shokhen M, Khazanov N, Albeck A
Proteins. 2007 Oct 2
Similar enzyme activation and catalysis in hemocyanins and tyrosinases
Decker H, Schweikardt T, Nillius D, Salzbrunn U, Jaenicke E, Tuczek F
Gene. 2007 Aug 15;398(1-2):183-91
Clinical, structural and functional implications of mutations and polymorphisms in human NADPH P450 oxidoreductase
Fluck CE, Nicolo C, Pandey AV
Fundam Clin Pharmacol. 2007 Aug;21(4):399-410
The cytochrome P450 aromatase lacking exon 5 is associated with a phenotype of nonclassic aromatase deficiency and is also present in normal human steroidogenic tissues
Pepe CM, Saraco NI, Baquedano MS, Guercio G, Vaiani E, Marino R, Pandey AV, Fluck CE, Rivarola MA, Belgorosky A
Clin Endocrinol (Oxf). 2007 Jul 2
Amino acids in the second transmembrane helix of the Lhca4 subunit are important for formation of stable heterodimeric light-harvesting complex LHCI-730
Corbet D, Schweikardt T, Paulsen H, Schmid VH
J Mol Biol. 2007 Jun 29;370(1):170-82
Modulation of human cyp19a1 activity by mutant nadph p450 oxidoreductase
Pandey AV, Kempna P, Hofer G, Mullis PE, Fluck CE
Mol Endocrinol. 2007 Jun 26
MPP1 links the Usher protein network and the Crumbs protein complex in the retina
Gosens I, van Wijk E, Kersten FF, Krieger E, van der Zwaag B, Marker T, Letteboer SJ, Dusseljee S, Peters T, Spierenburg HA, Punte IM, Wolfrum U, Cremers FP, Kremer H, Roepman R
Hum Mol Genet. 2007 Jun 21
Structure of the dimeric N-glycosylated form of fungal beta-N-acetylhexosaminidase revealed by computer modeling, vibrational spectroscopy, and biochemical studies
Ettrich R, Kopecky V Jr, Hofbauerova K, Baumruk V, Novak P, Pompach P, Man P, Plihal O, Kuty M, Kulik N, Sklenar J, Ryslava H, Kren V, Bezouska K
BMC Struct Biol. 2007 May 17;7:32
PSA/KLK3 AREI promoter polymorphism alters androgen receptor binding and is associated with prostate cancer susceptibility
Lai J, Kedda MA, Hinze K, Smith RL, Yaxley J, Spurdle AB, Morris CP, Harris J, Clements JA
Carcinogenesis. 2006 Dec 13
Influence of modulated structural dynamics on the kinetics of alpha-chymotrypsin catalysis. Insights through chemical glycosylation, molecular dynamics and domain motion analysis
Sola RJ, Griebenow K
FEBS J. 2006 Dec;273(23):5303-19
The human Vps29 retromer component is a metallo-phosphoesterase for a cation-independent mannose 6-phosphate receptor substrate peptide
Damen E, Krieger E, Nielsen JE, Eygensteyn J, van Leeuwen JE
Biochem J. 2006 Sep 15;398(3):399-409
Structure-function analysis of the coxsackievirus protein 3A: identification of residues important for dimerization, viral RNA replication, and transport inhibition
Wessels E, Notebaart RA, Duijsings D, Lanke K, Vergeer B, Melchers WJ, van Kuppeveld FJ
J Biol Chem. 2006 281(38):28232-43
The first crystal structure of tyrosinase: all questions answered?
Decker H, Schweikardt T, Tuczek F
Angew Chem Int Ed Engl. 2006 Jul 10;45(28):4546-50
Arrestin interaction with rhodopsin: conceptual models
Modzelewska A, Filipek S, Palczewski K, Park PS
Cell Biochem Biophys. 2006;46(1):1-15
Structural models of the snake venom factor V activators from Daboia russelli and Daboia lebetina
Segers K, Rosing J, Nicolaes GA
Proteins. 2006 Sep 1;64(4):968-84
CoverGRIS: Glycoprotein-Hormone Receptor Information System.
Van Durme J, Horn F, Costagliola S, Vriend G, Vassart G
Mol Endocrinol. 2006 Sep;20(9):2247-55 Journal cover partly made with YASARA:
Completely buried, non-ion-paired glutamic acid contributes favorably to the conformational stability of pyrrolidone carboxyl peptidases from hyperthermophiles.
Kaushik JK, Iimura S, Ogasahara K, Yamagata Y, Segawa S, Yutani K
Biochemistry. 2006 Jun 13;45(23):7100-12.
Structure coverGTP-Ras Disrupts the Intramolecular Complex of C1 and RA Domains of Nore1.
Harjes E, Harjes S, Wohlgemuth S, Muller KH, Krieger E, Herrmann C, Bayer P.
Structure 2006 May;14(5):881-8
An NMR structure determined with the help of YASARA, PDB ID 2FNF. Journal cover made with YASARA:
Fast empirical pK(a) prediction by Ewald summation.
Krieger E, Nielsen JE, Spronk CA, Vriend G.
J Mol Graph Model. 2006 Apr 25
The presence of multiple and differentially regulated interleukin-12p40 genes in bony fishes signifies an expansion of the vertebrate heterodimeric cytokine family.
Huising MO, van Schijndel JE, Kruiswijk CP, Nabuurs SB, Savelkoul HF, Flik G, Verburg-van Kemenade BM
Mol Immunol. 2006 Apr;43(10):1519-33
Repulsive separation of the cytoplasmic ends of transmembrane helices 3 and 6 is linked to receptor activation in a novel thyrotropin receptor mutant (M626I).
Ringkananont U, Van Durme J, Montanelli L, Ugrasbul F, Yu YM, Weiss RE, Refetoff S, Grasberger H.
Mol Endocrinol. 2006 Apr;20(4):893-903
ZNF674: A New Kruppel-Associated Box-Containing Zinc-Finger Gene Involved in Nonsyndromic X-Linked Mental Retardation.
Lugtenberg D, Yntema HG, Banning MJ, Oudakker AR, Firth HV, Willatt L, Raynaud M, Kleefstra T, Fryns JP, Ropers HH, Chelly J, Moraine C, Gecz J, Reeuwijk J, Nabuurs SB, de Vries BB, Hamel BC, de Brouwer AP, Bokhoven H
Am J Hum Genet. 2006 Feb;78(2):265-78
A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.
Kalay E, de Brouwer AP, Caylan R, Nabuurs SB, Wollnik B, Karaguzel A, Heister JG, Erdol H, Cremers FP, Cremers CW, Brunner HG, Kremer H.
J Mol Med. 2005 Dec;83(12):1025-32.
A novel GCAP1 missense mutation (L151F) in a large family with autosomal dominant cone-rod dystrophy (adCORD)
Sokal I, Dupps WJ, Grassi MA, Brown J Jr, Affatigato LM, Roychowdhury N, Yang L, Filipek S, Palczewski K, Stone EM, Baehr W
Invest Ophthalmol Vis Sci. 2005 Apr;46(4):1124-32
Interaction of nephrocystin-4 and RPGRIP1 is disrupted by nephronophthisis or Leber congenital amaurosis-associated mutations.
Roepman R, Letteboer SJ, Arts HH, van Beersum SE, Lu X, Krieger E, Ferreira PA, Cremers FP.
Proc Natl Acad Sci U S A. 2005 Dec 20;102(51):18520-5
A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.
Kalay E, de Brouwer AP, Caylan R, Nabuurs SB, Wollnik B, Karaguzel A, Heister JG, Erdol H, Cremers FP, Cremers CW, Brunner HG, Kremer H.
J Mol Med. 2005 Dec;83(12):1025-32
Definition of a new information-based per-residue quality parameter.
Nabuurs SB, Krieger E, Spronk CA, Nederveen AJ, Vriend G, Vuister GW.
J Biomol NMR. 2005 Oct;33(2):123-34.
Presence and absence of FSH receptor mutations provide some insights to spontaneous ovarian hyperstimulation syndrome physiopathology.
De Leener A, Montanelli L, Van Durme J, Chae H, Smits G, Vassart G, Costagliola S.
J Clin Endocrinol Metab. 2005 Nov 8;
JBC coverReconstruction of the Complete Ouabain-binding Pocket of Na,K-ATPase in Gastric H,K-ATPase by Substitution of Only Seven Amino Acids.
Qiu LY, Krieger E, Schaftenaar G, Swarts HG, Willems PH, De Pont JJ, Koenderink JB.
J Biol Chem. 2005 Sep 16;280(37):32349-55 Journal cover made with YASARA:
MPP5 recruits MPP4 to the CRB1 complex in photoreceptors.
Kantardzhieva A, Gosens I, Alexeeva S, Punte IM, Versteeg I, Krieger E, Neefjes-Mol CA, den Hollander AI, Letteboer SJ, Klooster J, Cremers FP, Roepman R, Wijnholds J.
Invest Ophthalmol Vis Sci. 2005 Jun;46(6):2192-201
Asn792 Participates in the Hydrogen Bond Network Around the K+-binding Pocket of Gastric H,K-ATPase.
Swarts HG, Koenderink JB, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2005 Mar 25;280(12):11488-94
A Proline-Rich Region in the Coxsackievirus 3A Protein Is Required for the Protein To Inhibit Endoplasmic Reticulum-to-Golgi Transport.
Wessels E, Duijsings D, Notebaart RA, Melchers WJ, van Kuppeveld FJ.
J Virol. 2005 Apr;79(8):5163-73
Protein sequence randomization: efficient estimation of protein stability using knowledge-based potentials.
Wiederstein M, Sippl MJ.
J Mol Biol. 2005 Feb 4;345(5):1199-212
Validation of protein structures derived by NMR spectroscopy.
Spronk CA, Nabuurs SB, Krieger E, Vriend G, Vuister GW.
Progress in NMR spectroscopy. 2004 45:315-337.
Making optimal use of empirical energy functions: Force-field parameterization in crystal space.
Krieger E, Darden T, Nabuurs SB, Finkelstein A, Vriend G.
Proteins. 2004 57(4):678-683
Delineation of the discontinuous-conformational epitope of a monoclonal antibody displaying full in vitro and in vivo thyrotropin activity.
Costagliola S, Bonomi M, Morgenthaler NG, Van Durme J, Panneels V, Refetoff S, Vassart G.
Mol Endocrinol. 2004 18(12):3020-34 Journal cover made with YASARA:
OmpT: Molecular Dynamics Simulations of an Outer Membrane Enzyme.
Baaden M, Sansom MS.
Biophys J. 2004 87(5):2942-53
Identification of the MMRN1 binding region within the C2 domain of human factor V.
Jeimy SB, Woram RA, Fuller N, Quinn-Allen MA, Nicolaes GA, Dahlback B, Kane WH, Hayward CP.
J Biol Chem. 2004 279(49):51466-71
DRESS: a database of REfined solution NMR structures.
Nabuurs SB, Nederveen AJ, Vranken W, Doreleijers JF, Bonvin AM, Vuister GW, Vriend G, Spronk CA.
Proteins. 2004 55(3):483-6.
Identification and molecular modelling of a mutation in the motor head domain of myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11).
Luijendijk MW, Van Wijk E, Bischoff AM, Krieger E, Huygen PL, Pennings RJ, Brunner HG, Cremers CW, Cremers FP, Kremer H.
Hum Genet. 2004 115(2):149-56.
A conformation-specific interhelical salt bridge in the K+ binding site of gastric H,K-ATPase.
Koenderink JB, Swarts HG, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2004 279(16):16417-24.
A structural and dynamic model for the interaction of interleukin-8 and glycosaminoglycans: support from isothermal fluorescence titrations.
Krieger E, Geretti E, Brandner B, Goger B, Wells TN, Kungl AJ.
Proteins. 2004 54(4):768-75.
A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26).
van Wijk E, Krieger E, Kemperman MH, De Leenheer EM, Huygen PL, Cremers CW, Cremers FP, Kremer H.
J Med Genet. 2003 40(12):879-84.
Fluorescence analysis of the Hansenula polymorpha peroxisomal targeting signal-1 receptor, Pex5p.
Boteva R, Koek A, Visser NV, Visser AJ, Krieger E, Zlateva T, Veenhuis M, van der Klei I.
Eur J Biochem. 2003 270(21):4332-8.
DJ-1( PARK7), a novel gene for autosomal recessive, early onset parkinsonism.
Bonifati V, Rizzu P, Squitieri F, Krieger E, Vanacore N, van Swieten JC, Brice A, van Duijn CM, Oostra B, Meco G, Heutink P.
Neurol Sci. 2003 24(3):159-60.
Quantitative Evaluation of Experimental NMR Restraints.
Nabuurs SB, Spronk CA, Krieger E, Maassen H, Vriend G, Vuister GW.
J Am Chem Soc. 2003 125(39):12026-12034.
The precision of NMR structure ensembles revisited.
Spronk CA, Nabuurs SB, Bonvin AM, Krieger E, Vuister GW, Vriend G.
J Biomol NMR. 2003 25(3):225-34.
Homology modeling.
Krieger E, Nabuurs SB, Vriend G.
Methods Biochem Anal. 2003;44:509-23.
Mutations in the DJ-1 gene associated with autosomal recessive early-onset parkinsonism.
Bonifati V, Rizzu P, van Baren MJ, Schaap O, Breedveld GJ, Krieger E, Dekker MC, Squitieri F, Ibanez P, Joosse M, van Dongen JW, Vanacore N, van Swieten JC, Brice A, Meco G, van Duijn CM, Oostra BA, Heutink P.
Science. 2003 299(5604):256-9
A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia.
van Swieten JC, Brusse E, de Graaf BM, Krieger E, van de Graaf R, de Koning I, Maat-Kievit A, Leegwater P, Dooijes D, Oostra BA, Heutink P.
Am J Hum Genet. 2003 72(4):1078.
Increasing the precision of comparative models with YASARA NOVA--a self-parameterizing force field.
Krieger E, Koraimann G, Vriend G.
Proteins. 2002 47(3):393-402.
Gain-of-function mutation in ADULT syndrome reveals the presence of a second transactivation domain in p63.
Duijf PH, Vanmolkot KR, Propping P, Friedl W, Krieger E, McKeon F, Dotsch V, Brunner HG, van Bokhoven H.
Hum Mol Genet. 2002 11(7):799-804.
Identification of different binding sites in the dendritic cell-specific receptor DC-SIGN for intercellular adhesion molecule 3 and HIV-1.
Geijtenbeek TB, van Duijnhoven GC, van Vliet SJ, Krieger E, Vriend G, Figdor CG, van Kooyk Y.
J Biol Chem. 2002 277(13):11314-20.
Models@Home: distributed computing in bioinformatics using a screensaver based approach.
Krieger E, Vriend G.
Bioinformatics. 2002 18(2):315-8.