Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Software Patents

The European Union currently faces a problem the USA are already suffering from today: the introduction of software patents, that allow to 'protect' even the simplest algorithms. At YASARA Biosciences, we are convinced that patents on algorithms are a very bad idea. Either an algorithm is trivial like the wheel, then it should not be patented at all, or it is complicated, then it is also well protected and does not need to be patented. Why protected? Because it is virtually impossible to steal a complicated algorithm by disassembling a compiled program. And you still have the copyright to protect the program itself.

It is our view that software patents reduce the resources available for research&development without providing a real advantage and thus reduce innovation and progress. If you manage to reprogram one of YASARA's algorithms just by looking at the screen, you are welcome to do so. We appreciate any competition as it boosts our own developments. To make a clear statement:

YASARA BIOSCIENCES WILL NEVER APPLY FOR A SOFTWARE PATENT.
(This guarantee is also part of the YASARA license agreement).

You can be sure that supporting YASARA will not result in new software patents that may hinder your own work later on. Instead we publish algorithms that are worth patenting in peer-reviewed journals to prevent others from claiming a patent on the same algorithm.

For more information, see: FFII , Eurolinux Alliance