CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)



Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).




Send a bug report by e-mail

This plugin sends a bug report, together with the latest execution log (stored as yasara/log/exec_*.log), click Help > Report error. It also adds an option to request YASARA updates, click Help > Check for update and Help > Request update.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2016/08/03

Download: reporter.zip


Molecular graphics


Visualize ligands

This plugin identifies ligands and highlights them, including the binding residues

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2017/10/24

Download: style.zip


GIF/MPEG Movie Clip Encoder

This plugin creates an MPEG movie or animated GIF of the rotating scene, click File > Save as > Animated GIF.

Written by: Emmanuel Bettler & Ahmet Sacan

License: GNU GPL

Last modified: 2015/10/08

Download: makemovie.zip


ConSurf coloring

This plugin colors the residues in the selected molecules by conservation scores assigned by the ConSurf webserver at consurf.tau.ac.il. If the object name is a valid PDB ID, the plugin will download the preassigned conservation scores, caching them for quick reuse later. If the object name is not a valid PDB ID, the plugin assumes that this is a private structure which you submitted manually to the server before, so that the B-factors already represent the conservation scores and coloring can start immediately. Coloring can be done in two ways. First by conservation gradient only: cyan is variable, gray is average and purple is conserved. Second by amino acid property and conservation blended together: polars are green, hydrophobics are yellow, negatives are red and positives are blue. Darker colors mean higher conservation, lighter colours mean lower conservation. With the second color option, two thresholds can be given for assigning high and low conservation. Defaults are 80% for upper and 60% for lower threshold. E.g. with an upper threshold of 80%, this means that all residues with a conservation score higher than 80% of the maximum conservation score are considered highly conserved. If the lower threshold is 60%, residues with a score between 60% of max and 80% of max are considered no so conserved. All other residues below the lower threshold are coloured in gray (means variable).

Written by: Joost Van Durme & Sebastian Maurer-Stroh. SWITCH Lab, VIB, Brussels, Belgium

License: GPL (www.gnu.org)

Last modified: 2012/12/31

Download: consurf.zip


Molecular dynamics


Sample cartesian space with CONCOORD

This plugin runs the CONCOORD program and creates an ensemble of structures that span the conformational space of the selected protein, click Edit > Sample > Object. Requires YASARA Version 4.3.13. Currently only Linux is supported. More information about CONCOORD can be found at http://www.mpibpc.gwdg.de/abteilungen/071/bgroot/concoord.html. CONCOORD is automatically downloaded from this site the first time you use the plugin. Please cite: B.L. de Groot, D.M.F. van Aalten, R.M. Scheek, A. Amadei, G. Vriend and H.J.C. Berendsen; "Prediction of protein conformational freedom from distance constraints", Proteins 29: 240-251 (1997). If the structure contains lots of bumps, this may cause convergence problems, so it is best to use only energy minimized structures.

Written by: Bert de Groot

License: GNU GPL

Last modified: 2017/04/15

Download: concoord.zip


Color atoms by force acting on them

This plugin colors all atoms by the force acting on them. This is helpful to identify regions of conformational stress. Blue means zero force (<1000 pN), red medium force and yellow maximum force (>5000 pN). Click View > Color > All by force.

Written by: Sander Nabuurs

License: GNU GPL

Last modified: 2014/03/20

Download: colorforce.zip


Molecular modeling


FoldX forcefield plugin

This plugin provides access to various tools from the FoldX molecular modeling and design program in YASARA. FoldX can be obtained from http://foldx.crg.es. Plugin updates and documentation are provided at http://foldxsuite.crg.eu/products#yasarapg Especially for academics, commercial users need a FoldX license.

Written by: Javier Delgado and Joost Van Durme

License: -

Last modified: 2018/02/07



This plugin performs a structural alignment with the help of various programs or web servers: Sheba by J.Jung & B.Lee, which is downloaded automatically from http://rex.nci.nih.gov/RESEARCH/basic/lmb/mms/sheba.htm in Linux, Multiprot by Shatsky, Nussinov & Wolfson and CE by Shindyalov & Bourne. YASARA Plugin developed at the IBCP France, see http://pbil.ibcp.fr/~ebettler/stages/mroche/. Click Analyze > Align.

Written by: Mikael Roche & Emmanuel Bettler

License: GNU GPL

Last modified: 2017/11/21

Download: align3d.zip


Interactive oligosaccharide builder

This plugin performs interactive building of oligosaccharides

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2017/09/20


Database interfaces


Interface to PDBFinderII

This plugin lets the user select residues, retrieves the PDBFinderII entry for the corresponding PDB file via HTTP and then colors the residues based on a selected property: sequence entropy/conservation, hotspots for insertions/deletions and lots of different quality indicators. The color gradient goes from blue (unimportant,perfect) over magenta and red (interesting,allright) to yellow (very important to look at,probably wrong). Grey indicates that no data are available. Click View > Color > Residue by feature

Written by: Elmar Krieger

License: GPL (www.gnu.org)

Last modified: 2017/05/23

Download: pdbfinder2.zip




OpenOffice/LibreOffice Import Filter

This plugin imports an OpenOffice/LibreOffice Impress Presentation and converts it to a YASARA movie. Click Options > Macro & Movie > Import movie.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2017/11/22

Download: openoffice.zip