CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)


There are four different stages of YASARA for Linux, Windows, Mac OS X and Android, aimed at increasingly complicated fields of application. A certain stage contains the features of all the previous stages, plus a number of additional functions to tackle a wider range of scientific questions. Features with unique properties which you will not find in other programs are marked with orange buckyballs below.

YASARA View - Molecular graphics, modeling and analysis, freely download now.

YASARA Model - Everything above, plus advanced molecular modeling

YASARA Dynamics - Everything above, plus molecular simulations

YASARA Structure - Everything above, plus structure prediction and validation, docking, knowledge-based potentials

YASARA NMR Module - NMR structure determination from your restraints

YARIA Module - NMR structure determination from your spectrum with the help of ARIA

YASARA/WHAT IF Twinset - Extensive structure validation (PDBReports) and WHAT IF functions

Bio-Prodict 3DM - The protein superfamily data integration platform

Android tablets and smartphones that can run interactive MD simulations starting at 175 EUR.

A stereoscopic molecular modeling lab for 250 EUR, and a cave for 700 EUR.

Read more about the philosophy behind YASARA.

System requirements: None, please download the free YASARA View to verify that YASARA runs on your computer (and please contact us if you encounter problems).

Stage I: YASARA View - Free download

YASARA View is available for free and contains all the functions you need to explore a macromolecular structure interactively. As a bonus, you get YASARA's innovative 3D engine, which is up to 10 times faster than what you usually know from OpenGL, you can load multiple structures at the same time, create publication-quality ray-traced images including labels, and program your own macros and Python plugins. Included is YASARA Movie, a player for multimedia presentations and tutorials created with any of the higher stages, as well as the YASARA Python module to simply 'import yasara' in your Python scripts.

Key features:

Click here for free download, click here for screenshots, click here for a complete feature list.

Stage II: YASARA Model

YASARA Model contains YASARA View and adds all the functions you need to explore, analyze and model small to macromolecules in a production environment. This includes many features you often miss: unlimited undo/redo, macro recorder, quad-buffered stereo with shutter glasses or stereoscopic screens. You can load thousands of structures at the same time, move them around independently and create multimedia presentations (YASARA Movies). These movies can be encoded as MPEGs and pasted into Powerpoint or played back with all stages of YASARA, including the free YASARA View.

Key features:

YASARA Model USB stick
YASARA Model costs 110 € / 126 $ for academic and 550 € / 632 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, Mac OS X costs 20% extra, red/cyan stereo glasses and shipping are included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, or check the screenshots, the complete feature list, or the license details.

Stage III: YASARA Dynamics
YASARA Dynamics

YASARA Dynamics contains YASARA Model and adds support for molecular simulations. In addition to YASARA's own force fields (NOVA, YAMBER) you can use other well known MD force fields like AMBER, and run accurate all-atom MD simulations in aqueous solution with Particle Mesh Ewald longrange electrostatics. YASARA Dynamics is not a "black box" with input and output files, but shows the MD simulation in real-time on screen. You can fully interact with the scene, pull atoms or whole molecules around and finally do the type of molecular modeling that Cyrus Levinthal already pioneered back in 1966 ("..do the same type of pulling and pushing in the computer that we can do with our hands while building actual models. ", cited from an article in Scientific American).

Key features:

YASARA Dynamics USB stick YASARA Dynamics costs 275 € / 316 $ for academic and 2200 € / 2530 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, Mac OS X costs 20% extra, red/cyan stereo glasses and shipping are included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, or check the screenshots, the complete feature list, the hardware recommendations for MD, or the license details.

Stage IV: YASARA Structure
YASARA Structure

YASARA Structure contains YASARA Dynamics and adds all the functions needed to predict and validate macromolecular structures, including ligand docking and highly accurate force fields with knowledge-based potentials. If you already own one of the other YASARA stages, you can upgrade easily, just contact us for a quote.

Key features:

YASARA Structure USB stick YASARA Structure costs 375 € / 431 $ for academic and 3300 € / 3795 $ for commercial use, including one year of support and updates. This price includes Windows and Linux, Mac OS X costs 20% extra, red/cyan stereo glasses and shipping are included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, or check the screenshotsthe complete feature list, the hardware recommendations for MD, or the license details.


The YASARA NMR Module solves protein structures at the touch of a button, based on the protein sequence and distance-, dihedral-angle and RDC restraints. Input files are compatible with X-PLOR, folding and refinement are visualized in real-time on screen, allowing to identify problematic restraints. Floating assignments and non-standard residues are supported, all the details are described here.

YASARA NMR Module The YASARA NMR Module is an add-on for YASARA Structure and costs 50 € / 57 $ for academic and 500 € / 575 $ for commercial use, including one year of support and updates. This price includes Windows and Linux, Mac OS X costs 20% extra, customers in Austria have to add 20% VAT. If you do not have YASARA Structure yet, click here to order or get a quotation and click here for license details, otherwise contact us directly.

YARIA Module

The YARIA Module integrates the YASARA NMR module above with ARIA, the program for automatic NOE assignment developed by the group of Prof. Michael Nilges at Institut Pasteur, Paris. With the YARIA module, you can fully automatically turn your NMR spectrum into a 3D structure of unique quality. All the details are described here.

YARIA Module The YARIA Module is developed and supported by NMR experts Dr. Chris Spronk and Dr. Benjamin Bardiaux, prices start at 250 EUR for academic users if purchased in 2017. In addition you need licenses of YASARA Structure, the YASARA NMR module and ARIA. The YARIA Module is conveniently distributed together with YASARA, please contact us for detailed pricing information. You can either order it together with YASARA Structure, or add it to your existing YASARA license.

3DM - the protein superfamily data integration platform

The Bio-Prodict 3DM information systems are protein super-family platforms that collect, combine and integrate many different types of protein-related data. 3DM systems are designed to facilitate the exploration of sequence-structure-function relations, and have successfully been used many times to elucidate the function of individual amino acids, predict the effects of mutations, among others.

3DM features The 3DM platform is developed and distributed by Bio-Prodict, a CMBI spin-off company like YASARA Biosciences. Please contact Email for details and pricing information. An introductory movie can be watched at the Bio-Prodict site, more details about YASARA integration are available here.

The WHAT IF / YASARA Twinset

The Twinset is a customized joint-distribution of WHAT IF and YASARA Dynamics or YASARA Structure (currently Linux and Windows only). With over 3500 citations, WHAT IF is a widely used program for structure validation and modeling. In the Twinset, WHAT IF inherits YASARA's user interface, graphics engine, macro language, unlimited undo/redo etc, so that WHAT IF functions become easily accessible.

The Twinset is freely available, but you need licenses for YASARA Dynamics or YASARA Structure and also WHAT IF. Click here for WHAT IF license details, and note that WHAT IF is now shareware/donationware. Customers in Austria have to add 20% VAT.

To order the Twinset, just place a normal order for YASARA Dynamics or YASARA Structure and then request the Twinset upgrade from support. If you already own YASARA, email us your YASARA serial number.

Molecular modeling on Android for 175 EUR
Android devices

Since April 2013, YASARA is available for selected Android smartphones and tablets, providing today's most feature-complete mobile molecular modeling environment, including interactive MD simulations. Tablet prices start at 175 EUR, two videos and all the details are available here.

The 3D molecular modeling lab for 250 EUR
3D Molecular modeling lab

Stereoscopic 3D molecular modeling hardware has become easily affordable, so that entire classrooms can enjoy this unique experience. The image on the right shows the easiest and cheapest solution: 3D vision is provided using 'passive stereo', where the images for left and right eye are shown in odd and even pixel lines and separated using flicker-free polarized glasses. The first popular screens with this feature were the Zalman ZM-M215W, ZM-M220W and ZM-M240W, costing around 200 EUR. Unfortunately it appears that Zalman discontinued this product line, so they are now mostly available as refurbished second hand models. But there are many follow up products, googling for passive stereo odd even finds e.g. the LG D2342P, the HP 2311x, the AOC e2352Phz or the Viewsonic V3D231. The big advantage is that this type of display is directly supported by YASARA with any graphics card and any operating system (no expensive Quadro/FireGL cards or special video drivers are needed). You can move your molecules through 3D space using the Connexion 3D SpaceNavigator with six degrees of freedom. Order now for 50 EUR.
Notes: The ZM-M220W has a resolution of 1680×1050 pixels. The polarized glasses ensure that the left eye sees only the odd pixel lines, while the right eye sees the even lines. So the resolution is reduced to 1680×525 pixels per eye as soon as the glasses are put on. This is hardly noticeable when looking at molecules, but becomes apparent when looking at characters. Text is therefore harder to read than with alternative, more expensive stereo solutions. Without glasses, the screen behaves just like any other screen and can be used for everyday work. It has a quite glossy surface, reflections can be a problem in bright rooms, but are hardly noticeable in somewhat darker 'molecular modeling caves'. At least YASARA Model is required.

The 3D modeling showcase: a huge 3DTV for 380 EUR
LG 42LB620V

If you want to demonstrate 3D modeling on a large screen, we recommend passive 3DTVs like the LG 42LB620V shown on the right. With a diagonal of 42" (107 cm), two polarized 3D glasses and a price of 380 EUR, this 3DTV is an excellent deal that will please your audience. Passive 3DTVs use exactly the same principle as described above for passive 3D computer screens, so they will work with any operating system and any graphics card, with YASARA running in window or fullscreen mode.
Notes: Make sure to buy a screen with a resolution of 1920×1080 pixels (FullHD). Since the images for left and right eye are shown in odd and even pixel lines, this leaves an effective resolution of 1920×540 pixels per eye, and you certainly do not want a lower resolution on such a large screen. Higher resolutions would of course be even better, but will only be supported by YASARA later this year and also require an advanced GPU with HDMI 2.0 connection. It is essential that the 3DTV supports a display mode where the input signal is shown directly on screen, without scaling (overscan) and other post-processing (which would destroy the stereo effect). On LG 3DTVs, you can set this display mode by labeling the input with "PC" (push the "Settings" button on the remote, then go to Input > HDMI1, push the red button with the single white dot and select the "PC" label). If your graphics card/notebook only has a DVI output, don't forget to buy a DVI->HDMI adapter and a HDMI cable. Finally, it is noteworthy that passive stereo screens have a certain viewing volume. On the LG 42LB620V, your head should be located about 2 meters away, aligned with the bottom of the screen (i.e. you should be sitting or the screen should be hanging high up on the wall). Inside the viewing volume, the 3D effect is crystal clear, but outside, there can be considerable ghosting. At least YASARA Model is required, click Window > Stereo > Interlaced to enable stereo. If the stereo is 'inside out', click Window > Stereo > Swap left and right.

High resolution 3D modeling for 350 EUR
Viewsonic V3D241wm

High resolution 3D stereo with active shutter glasses is the next higher level, since it does not suffer from the reduced resolution of the passive screens above. The probably easiest solution with the best price/performance ratio is the Viewsonic V3D241wm shown on the right. The screen with a 24"/60cm diagonal has a resolution of 1920×1080 pixels and a non-reflective surface, it is thus well suited for everyday work. It functions with every operating system and every graphics card (nVIDIA/AMD) that can display quad-buffered stereo with 100 or 120Hz at a resolution of 1920×1080 pixels. The shutter glasses are included in the 350 EUR package. A slightly more expensive but also more commonly used and more flexible solution is nVIDIA's 3D Vision system, check the guidelines here and here. Other suppliers of 3D glasses are eDimensional and RealD.
Notes: Your graphics card must have a dual-link DVI connector and support quad buffered OpenGL stereo, a feature which is normally only available in workstation products like nVIDIA Quadro and AMD FireGL. You do not need the very expensive high-end Quadros with mini-DIN stereo connector, since the shutter glasses are supplied with the screen and plug into the screen with a cable, neither emitter nor batteries are required. Only one pair of glasses can be connected, so this system is for one person only. And since the monitor does not know the difference between left and right image, you may have to swap left and right in YASARA on startup. The aspect ratio of 16:9 is very movie-like, you may have to fiddle with your desktop settings to avoid windows that are too wide to read. The screen shows very little ghosting, which becomes noticeable mainly in the bottom 5cm. At least YASARA Model is required.

The 3D molecular modeling cave for 700 EUR
3D Molecular modeling cave

Recently also specialized 3D beamers, that previously cost above 10000 EUR, have finally become mainstream technology. You can now easily build your private molecular modeling showroom, projecting giant 3D views that measure several meters along the diagonal. The image on the right shows a 3D beamer from Viewsonic, costing around 500 EUR. The beamer projects the images for left and right eye alternatingly with 120 Hz. So you additionally need shutter glasses to separate the images, the probably best choice are glasses with DLP-link like the Viewsonic PGD-250 (~80 EUR) or the XPAND Edux3 (~80 EUR). An alternative with a less comfortable infrared emitter are the nuVisionGX glasses shown on the right (~200 EUR). Any beamer that is 3D-ready, features 'DLP-link' and supports a 120 Hz mode over VGA or DVI cable should work with YASARA, to see examples click here, then select 'Supported 3D projectors'.
Notes: Tests have been done in Linux, where you need to add a 120Hz modeline to your xorg.conf. Other operating systems work too if they allow you to choose a 120Hz video mode in their display settings. Additionally, your graphics card must support quad buffered OpenGL stereo, a feature which is normally only available in workstation products like nVIDIA Quadro and AMD FireGL. These cards often also have a mini-DIN connector for the shutter glasses, which is however not needed if you chose glasses with DLP-link (see above). The only disadvantage of DLP-link glasses is that you sometimes need to manually flip left and right image. At least YASARA Model is required to display stereo.

DTI Virtual Window
DTI Virtual Window

The Virtual Window is an autostereoscopic 19" LCD/TFT screen that allows you to see 3D without any additional glasses. Just press a button to switch between 3D and 2D mode. Order now from Dimension Technologies.
The Virtual Window provides a 3D button, that activates a filter which directs the odd pixel columns to the left eye, and the even pixel columns to the right eye. So the original resolution of 1280×1024 pixels is reduced to 640×1024 pixels per eye, leading to reduced text quality, just like the Zalman screen above. Since there are no glasses, the 3D view depends on your position and inverts if the head is moved too far. The Virtual Window requires at least YASARA Model and a video card that supports quad-buffered OpenGL stereo, e.g. NVIDIA Quadro cards.

The Models@Home cluster system

Models@Home is a distributed computing environment that follows the spirit of the famous Seti@Home project, but is not tied to a specific application. Instead you can run all your favourite programs in parallel, without any need to modify or adapt them. The Models@Home screensaver allows to turn a heterogeneous Windows / Linux network into a uniform cluster.  At the CMBI , Models@Home is used for most protein modeling tasks, all YASARA force fields were developed with computer power provided by Models@Home. Models@Home is freely available including the source code.
Click here to download, click here for more information.