Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Order the YASARA Android Tablet

The Ramos W32 is the first Android tablet that can run YASARA as well as existing Android apps. As a special service, we offer all users in the European Union who paid for their YASARA license the possibility to order the tablet from us directly with YASARA preinstalled (no credit card/advance payment required, no potential customs fees). The price is 175 EUR per tablet + 20 EUR shipping, and does not cover our costs, so it's limited to one tablet (single users) or two tablets (group leaders). Additional tablets can be ordered for 250 EUR per tablet + 20 EUR shipping. Please tell us if the standard European power plug does not work for you (e.g. UK). Note that YASARA Structure is not available on Android yet, so the tablet will contain at most YASARA Dynamics (even if you own a YASARA Structure license). To place an order, send an email with your YASARA serial number and the header 'Android Tablet Order' to



The tablet can also be ordered directly from the manufacturer in China. Their webshop is very reliable and handled all our orders without complaint. The price is around 270 USD including shipping with DHL.

Here are the complete technical details of the Ramos W32:

OS: Android 4.0
CPU: Intel Atom Z2460 1.6 GHz
GPU: PowerVR SGX540
RAM:   1GB DDR3
Storage: 16GB
Screen: 10.1 inch (25.6 cm) IPS Multi-Touchscreen
Resolution: 1280 x 800 Pixels
Visible Angle: 178°
Extend Card: Support TF card up to 32GB extended
Camera: Front 1.3 M
Gravity Sensor: Yes
Google Play Store: Yes
WIFI: 802.11 b/g/n
Bluetooth: Built-in
Flash: Support Flash 11.0 and HTML 5
Earphone Interface: 3.5mm
Video: 1080P, AVI/MOV/MP4/RMVB/FLV/MKV…
Music: MP3/WMA/WAV/APE/AAC/FLAC/OGG
Ebook: UMD, TXT, PDF, HTML, RTF, FB2…
Work Time: Up to 6-7 hours
Battery: 5400mAh
Language: Czech, Dansk, German, English, Spanish, Russian, French, Italian, Dutch, Norwegian, Polski, Greek, Portuguese, Svenska, Turkey, Korean, Japanese, Simplified Chinese, Traditional Chinese
Size: 258.3 x 164 x 9.5mm
Weight: 535g


Ramos W32 Android tablet
The tablet above is the Ramos W32, the world's first Intel-inside tablet.
The video above shows YASARA running on the Ramos W32 tablet, providing general YASARA usage instructions  and an example for coloring protein surfaces by electrostatic potential using a Poisson-Boltzmann calculation. Everything works exactly the same on smartphones.