CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)


Research topics



To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). MacOS tries to hide the yasara directory from you: open Finder, browse to the YASARA application and click on 'Show package contents' in the context menu to see the yasara directory.

If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.



Figure: A snapshot from the movie
A 3D model of SARS-CoV-2 for interactive exploration, with components explained and built using Cryo-EM results from Yao et al. (2020) Cell 183,730-738.

Written by: Kornel Ozvoldik

License: GNU GPL

Last modified: 2021/02/01

Download: sarscov2.zip


CASP8 meeting on Sardinia 2008/12/04

Figure: A snapshot from the movie
A summary of the protein structure prediction tricks used by YASARA during CASP8.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2020/05/25

Download: casp8.zip


Methionine Synthase

Figure: A snapshot from the movie
An overview of the catalytic activity of methionine synthase

Written by: Richard Deth & Elmar Krieger

License: GNU GPL

Last modified: 2020/05/20

Download: metsynthase.zip


PhD Thesis Defence 2004/09/27 by Elmar Krieger

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2020/05/20

Download: thesis.zip


PhD Thesis Defence 2006/02/09 by Sander Nabuurs

Figure: A snapshot from the movie
Written by: Sander Nabuurs

License: GNU GPL

Last modified: 2020/05/18

Download: thesis2.zip