CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)


YASARA Screenshots

Below you find a large number of YASARA screenshots. All images are exact copies of the YASARA window, taken on an nVIDIA Geforce and Linux. The Windows and Mac OS X versions look identical, except for the user interface.

Figure: An example for the AddEnv command.

Figure: An example for the AddHyd command.

Figure: An example for the AddRes command.

Figure: An example for the AddRes command.

Figure: An example for the Tabulate command.

Figure: An example for the AlignPDBMol command.

Figure: An example for the AlignAtom command.

Figure: An example for the Align command.

Figure: An example for the Angle command.

Figure: An example for the AtomTexture command.

Figure: An example for the AtomTexture command.

Figure: An example for the BallStickRadius command.

Figure: An example for the BallStick command.

Figure: An example for the Ball command.

Figure: An example for the BLAST command.

Figure: An example for the BuildAtom command.

Figure: An example for the BuildGroup command.

Figure: An example for the BuildLoop command.

Figure: An example for the BuildMol command.

Figure: An example for the BuildRes command.

Figure: An example for the Cell command.

Figure: An example for the Cell command.

Figure: An example for the Cell command.

Figure: An example for the Check command.

Figure: An example for the Check command.

Figure: An example for the ColorBonds command.

Figure: An example for the ColorBG command.

Figure: An example for the Color command.

Figure: An example for the Color command.

Figure: An example for the CorrectCis command.

Figure: An example for the Crystallize command.

Figure: An example for the Cut command.

Figure: An example for the DCCM command.

Figure: An example for the Deflate command.

Figure: An example for the Dihedral command.

Figure: An example for the Distance command.

Figure: An example for the DrawLine command.

Figure: An example for the DuplicateView command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the FillCellObj command.

Figure: An example for the FillCellObj command.

Figure: An example for the FillCellWater command.

Figure: An example for the FirstSurf command.

Figure: An example for the FixHydAngle command.

Figure: An example for the Fix command.

Figure: An example for the Fog command.

Figure: An example for the Font command.

Figure: An example for the ForceField command.

Figure: An example for the Force command.

Figure: An example for the FormEnergy command.

Figure: An example for the Hide command.

Figure: An example for the Inflate command.

Figure: An example for the JoinObj command.

Figure: An example for the LabelDis command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the LightSource command.

Figure: An example for the ListCon command.

Figure: An example for the ListHBo command.

Figure: An example for the ListInt command.

Figure: An example for the ListSMILES command.

Figure: An example for the MakeImage command.

Figure: An example for the MakeImageObj command.

Figure: An example for the MakeImageObj command.

Figure: An example for the MakeTextObj command.

Figure: An example for the MakeWin command.

Figure: An example for the Oligomerize command.

Figure: An example for the OptimizeLoop command.

Figure: An example for the Optimize command.

Figure: An example for the Optimize command.

Figure: An example for the OriVec command.

Figure: An example for the pH command.

Figure: An example for the PolygonPar command.

Figure: An example for the Pos command.

Figure: An example for the Print command.

Figure: An example for the PrintHUD command.

Figure: An example for the RayTrace command.

Figure: An example for the RayTrace command.

Figure: An example for the RDF command.

Figure: An example for the ReplaceRes command.

Figure: An example for the ReplaceRes command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleLoop command.

Figure: An example for the Scale command.

Figure: An example for the SecStr command.

Figure: An example for the Select command.

Figure: An example for the ShowArrow command.

Figure: An example for the ShowButton command.

Figure: An example for the ShowCavi command.

Figure: An example for the ShowCone command.

Figure: An example for the ShowCon command.

Figure: An example for the ShowESP command.

Figure: An example for the ShowHBo command.

Figure: An example for the ShowImage command.

Figure: An example for the ShowInt command.

Figure: An example for the ShowInt command.

Figure: An example for the ShowIonSites command.

Figure: An example for the ShowKBP command.

Figure: An example for the ShowKBP command.

Figure: An example for the ShowRota command.

Figure: An example for the ShowSecStr command.

Figure: An example for the ShowSecStr command.

Figure: An example for the ShowSecStr command.

Figure: An example for the ShowCell command.

Figure: An example for the ShowGrid command.

Figure: An example for the ShowSphere command.

Figure: An example for the ShowPolygon command.

Figure: An example for the ShowRing command.

Figure: An example for the ShowSkySphere command.

Figure: An example for the ShowSurf command.

Figure: An example for the ShowTab command.

Figure: An example for the ShowTab command.

Figure: An example for the ShowTorus command.

Figure: An example for the ShowTrace command.

Figure: An example for the ShowWire command.

Figure: An example for the Show command.

Figure: An example for the SolvEnergy command.

Figure: An example for the Stick command.

Figure: An example for the Style command.

Figure: An example for the Style command.

Figure: An example for the Style command.

Figure: An example for the SupMulti command.

Figure: An example for the Sup command.

Figure: An example for the SurfPar command.

Figure: An example for the SurfDis command.

Figure: An example for the SurfDis command.

Figure: An example for the SurfESP command.

Figure: An example for the Surf command.

Figure: An example for the SwapAtom command.

Figure: An example for the SwapPosAtom command.

Figure: An example for the SwapRes command.

Figure: An example for the TempCtrl command.

Figure: An example for the TimeStep command.

Figure: An example for the Transformation command.

Figure: An example for the Twist command.

Figure: An example for the TypeAtom command.

Figure: An example for the TypeAtom command.

Figure: An example for the TypeBond command.

Figure: An example for the WriteReport command.