CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)


Structure determination



Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.


Refine an NMR ensemble in vacuo

This macro refines a roughly folded structure in vacuo to create a realistic fold

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2017/10/28


Refine an NMR ensemble in explicit solvent

This macro refines an NMR ensemble in explicit solvent (HOH or DMSO) to increase the accuracy

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2017/10/28


Fold an ensemble of NMR structures

This macro folds a structure from the stretched-out conformation using NMR restraints

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/12/27

Download: nmr_fold.mcr


Set default parameters for NMR structure determination

This macro is included by others to set default parameters

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/12/27


Analyze and merge an NMR ensemble

This macro analyzes an NMR ensemble and merges the members into a single PDB file

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/10/16

Download: nmr_analyze.mcr


Solve an NMR structure with fixed quality

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format. Contrary to the normal nmr_solve macro, it refines only those structures in water, that match a quality criterion, and performs an unlimited number of folding runs until the ensemble has the requested size

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/10/16


Solve an NMR structure

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/02/27

Download: nmr_solve.mcr


Solve an NMR structure

This macro refines a single structure or structure ensemble (provided in PDB format) in vacuo & explicit solvent and finally analyzes the result

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/02/27

Download: nmr_refine.mcr