CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)


Structure determination



Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.


Refine an NMR ensemble in explicit solvent

This macro refines an NMR ensemble in explicit solvent (HOH or DMSO) to increase the accuracy

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2018/12/05


Solve an NMR structure with fixed quality

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format. Contrary to the normal nmr_solve macro, it refines only those structures in water, that match a quality criterion, and performs an unlimited number of folding runs until the ensemble has the requested size

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2018/02/05


Refine an NMR ensemble in vacuo

This macro refines a roughly folded structure in vacuo to create a realistic fold

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2018/02/05


Fold an ensemble of NMR structures

This macro folds a structure from the stretched-out conformation using NMR restraints

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2018/02/05

Download: nmr_fold.mcr


Analyze and merge an NMR ensemble

This macro analyzes an NMR ensemble and merges the members into a single PDB file

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2018/02/05

Download: nmr_analyze.mcr


Set default parameters for NMR structure determination

This macro is included by others to set default parameters

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2018/02/05


Solve an NMR structure

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/02/27

Download: nmr_solve.mcr


Solve an NMR structure

This macro refines a single structure or structure ensemble (provided in PDB format) in vacuo & explicit solvent and finally analyzes the result

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2016/02/27

Download: nmr_refine.mcr