Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Building small molecules with YASARA

In YASARA Model and above, a sophisticated small molecule builder is available to construct your molecules manually in just a few seconds. (Alternatively, automatic building from SMILES strings is supported in all YASARA stages, and larger molecules can be built from their sequence).

Movie 1 on the top right shows how building works in practice, drawing on the example of tiotropium, an anti-asthmatic bronchodilator known as 'Spiriva', which is also shown in the bottom right figure 2. Interactive building is an iterative process, where you select hydrogen atoms that should be replaced or bridged with functional groups. YASARA provides over 50 groups to choose from, each with up to four alternative attachment points. As known from 2D molecule editors, you can simply 'write' new atoms and adapt bonds by typing on the keyboard, e.g. click on a hydrogen and type 'C' to turn it into a CH3 group, or 'O' to turn it into an OH group (hydrogens are thus added automatically).

It is also worth mentioning that YASARA can record user input as a macro, generating the following code while building the tiotropium in movie 1 (comments have been added manually):

# Start with a 7-ring 
BuildGroup Cycloheptyl
# Add nitrogen bridge
BridgeAtom 9,18,Nitrogen
# Add two methyl groups to nitrogen bridge
SwapAtom 18 19,Carbon,UpdateBonds=yes,UpdateHyd=yes
# Add oxygen bridge
BridgeAtom 11,14,Oxygen
# Add ester
SwapAtom 1,Ester,AttachPoint=2
# Add methyl group
SwapAtom 1,Carbon,UpdateBonds=yes,UpdateHyd=yes
# Add hydroxyl group
SwapAtom 2,Oxygen,UpdateBonds=yes,UpdateHyd=yes
# Add thiophene rings
SwapAtom 4 5,Pyrryl,AttachPoint=2
SwapAtom 5 14,Sulfur,UpdateHyd=yes

The screenshot in the middle is from the help movie "4.1 Building small molecules", which starts with an easier example (4-Iododiazenyl- 8-methyl- pyromellitimide) and then continues with tiotropium.

The molecule builder makes extensive use of YASARA's knowledge about pH-dependent bond orders and protonation states. Having built the molecule, you can proceed to optimize its geometry, either semi-empirically using the built-in MOPAC, or empirically with automatic force field parameter assignment using YASARA AutoSMILES.

Movie 1: The video above explains how to build small molecules in YASARA. The example molecule is tiotropium, which is a bronchodilator that relaxes muscles in the airways and increases air flow to the lungs. Many thanks to Steven Martin for guiding through the movie.
Space
Building 4-Iododiazenyl-8-methyl-pyromellitimide
Figure 1: Screenshot from YASARA's help movie 4.1, showing how to build 4-Iododiazenyl- 8-methyl- pyromellitimide. Users of the free YASARA View can download the movie from the repository. Double bonds are colored yellow.


Building tiotropium
Figure 2: Another view of tiotropium/Spiriva shown in movie 1 above. Double bonds are colored yellow.