CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)


Structure prediction



Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.


Showing the docking results interactively

This macro provides an interactive player to cycle through the docking poses and clusters

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/05/20

Download: dock_play.mcr


Docking a covalently bound ligand to a receptor

This macro predicts the structure of a covalent ligand-receptor complex. It can also continue a docking run that got interrupted. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/05/03


Docking many ligands to a receptor to perform virtual screening

This macro docks multiple ligands against a receptor and saves a sorted table of their binding energies, as well as the corresponding complexes

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/04/02


Docking a ligand to a receptor

This macro predicts the structure of a ligand-receptor complex. It can also continue a docking run that got interrupted. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/04/02

Download: dock_run.mcr


Docking a ligand to a receptor locally

This macro samples local ligand conformations in a user-supplied complex. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/01/25


Docking a ligand to a receptor ensemble with flexible side-chains

This macro predicts the structure of a ligand-receptor complex. Receptor flexibility is considered by creating a receptor ensemble with alternative high-scoring solutions of the side-chain rotamer network. An analysis log file is written at the end. The macro can also continue a docking run that got interrupted, especially if the scene has not been moved or rotated manually during the docking.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2019/01/25


Building a homology model

This macro builds a homology model using a FASTA sequence of the target, and optionally template structures and alignments

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2017/11/07

Download: hm_build.mcr


Building a homology model

This macro builds a homology model using a FASTA sequence of the target, and optionally template structures and alignments. It takes some shortcuts (alignment quality, number of templates, refinement) to finish as quickly as possible

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2016/12/27