Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


Mail Order / Quotation Request


If this web order form does not suit your needs, just email us:
Email contact

YASARA Structure will be delivered to you on an USB stick including an invoice, which you can then pay by bank transfer, cheque, credit card or PayPal. That is why we have to ask for your full address.
Note that you can also use the form below to request a quotation without placing an order.
If you plan to order YASARA for multiple users/group leaders or more than one year of support, visit the license fee page for detailed pricing information.


Please customize your personal edition of
YASARA Structure

NMR Module:   Yes, include the module for NMR structure determination
Your operating system:
Your preferred bits:
Your processor:
Type of usage:
Update and support years:
To read about the benefits of ordering more than one year click here.
Please use only plain English characters in the fields below.
Your first name:
Your Middle initials:
Your family name:
Department,Room:
University/Company:
Street,Number:
ZIP(Postcode):
City,State:
Country:
Please doublecheck the email address, it is essential for downloads, updates and support.
What shall we do?




YASARA is linked with the Simple Direct Media Layer library which is released under the GNU LPGL. Click here for LGPL compliance information.