Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 


Mail Order / Quotation Request


If this web order form does not suit your needs, just email us:
Email contact

You will receive a download link and an invoice by email (please provide a non-anonymous email), which you can then pay by bank transfer, credit card or PayPal. If you can only pay by check, please add 100 EUR for bank fees.
Note that you can also use the form below to request a quotation without placing an order.
If you plan to order YASARA for multiple users/group leaders or more than one year of support, visit the license fee page for detailed pricing information.


Please customize your personal edition of
YASARA Structure

VR Workstation:
(EU countries only)
  Yes, include the Virtual Reality Workstation for 175 EUR
NMR Module:   Yes, include NMR structure determination from restraints
Your operating system:
Your preferred bits:
Your processor:
Type of usage:
Update and support years:
To read about the benefits of ordering more than one year click here.
Please use only plain English characters in the fields below.
Your first name:
Your Middle initials:
Your family name:
Department,Room:
University/Company:
Street,Number:
ZIP(Postcode):
City,State:
Country:
Please doublecheck the email address, it is essential for downloads, updates and support.
What shall we do?




YASARA is linked with the Simple Direct Media Layer library which is released under the GNU LPGL. Click here for LGPL compliance information.