Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Building oligosaccharides with YASARA


YASARA provides an interactive oligosaccharide builder, with on-the-fly energy minimization:

  • Click Edit > Build > Oligosaccharide.
  • Select the first monosaccharide to start with, choosing between alpha/beta and D/L-isomers (Figure 1).
  • Select the next monosaccharide to join (marking the two hydroxyl groups that should form the glycosidic bond) and watch YASARA perform the oligomerization, derive force field parameters and energy minimize the growing oligosaccharide (Figure 2). The example movie shows how lactose is built from galactose and glucose.
  • Continue joining additional building blocks or add other modifications.



Interactive sugar builder
Figure 1: Building oligosaccharides, choosing the first monosaccharide

Figure 2: Screen recording of YASARA's interactive oligosaccharide builder, showing how lactose is built from galactose and glucose. A higher quality version can be watched at YouTube, click on 'Watch in high quality' below the video.