Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 


Update or full download for registered users


Normally you just have to fill in your email address or serial number and press the 'Update' button (the serial number is required if you download your first update, and can be found in the first mail or by clicking on Help > About YASARA). You will then receive an email with a download link.
However, if you want to download the complete program, possibly for a different computer or operating system, additionally type '1.1.1' in the 'Update from YASARA version' field and choose a new operating system or processor.


Be careful in the following situations:

  • You requested an update but did not install it: now our database is out of sync with your installation. You must also input your current YASARA version to get the correct update (click Help > About YASARA to display your current version, or simply Help > Request update).

  • You want to change your operating system or processor: just choose the new one from the list.

  • You own a group leader license with two registered email addresses: best enter your email address instead of the serial number to make sure that the update is not sent to the other person, or configure the update receiver here.

  • If you are struggling with a Windows virus scanner that does not permit to download an *.exe installer, or is even broken (e.g. F-Secure/Avira have not been able to fix a false alarm about Trojan.TR/Crypt.EPACK.Gen2 since 2021), enter ZIP in the 'Update from YASARA version' field to get a ZIP archive instead of an *.exe installer.

  • You want to use YASARA on different computers with different operating systems: in this case, there are two options. 1) Choose a master installation which you keep up-to-date. Select the appropriate combination of operating systems such that the master's OS is listed first. Then copy the updated YASARA folder to your other machines. 2) Update each installation independently. In this case, always type in the YASARA version you want to update and choose the right operating system.

  • You own the YASARA/WHATIF Twinset but want to download YASARA alone to run on computers with little memory: simply enter NoTwinset in the 'Update from YASARA version' field.

Update information

Your serial number is displayed on YASARA's startup screen and in the Help>About menu.
Update from YASARA version:
Type in 1.1.1 above to get the complete program, not just an incremental update.
Your operating system:
Your preferred bits:
Your processor:
 



YASARA is linked libraries released under the GNU LPGL. Click here for LGPL compliance information