CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

Update or full download for registered users

Normally you just have to fill in your email address or serial number and press the 'Update' button (the serial number is required if you download your first update, and can be found in the first mail or by clicking on Help > About YASARA). You will then receive an email with a download link.
However, if you want to download the complete program, possibly for a different computer or operating system, additionally type '1.1.1' in the 'Update from YASARA version' field and choose a new operating system or processor.

Be careful in the following situations:

  • You requested an update but did not install it: now our database is out of sync with your installation. You must also input your current YASARA version to get the correct update (click Help > About YASARA to display your current version, or simply Help > Request update).

  • You want to change your operating system or processor: just choose the new one from the list.

  • You own a group leader license with two registered email addresses: best enter your email address instead of the serial number to make sure that the update is not sent to the other person, or configure the update receiver here.

  • You received YASARA on USB stick. In this case enter your serial number instead of your email address when updating for the first time.

  • You want to use YASARA on different computers with different operating systems: in this case, there are two options. 1) Choose a master installation which you keep up-to-date. Select the appropriate combination of operating systems such that the master's OS is listed first. Then copy the updated YASARA folder to your other machines. 2) Update each installation independently. In this case, always type in the YASARA version you want to update and choose the right operating system and processor. Do not leave them 'still the same'.

  • You own the YASARA/WHATIF Twinset but want to download YASARA alone to run on computers with little memory: simply enter NoTwinset in the 'Update from YASARA version' field.

Update information

Your serial number is displayed on YASARA's startup screen and in the Help>About menu.
Update from YASARA version:
Type in 1.1.1 above to get the complete program, not just an incremental update.
Your operating system:
Your preferred bits:
Your processor:

YASARA is linked with the Simple Direct Media Layer library which is released under the GNU LPGL. Click here for LGPL compliance information