Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

Latest news on how to obtain VR headsets that work best with YASARA

YASARA works best with headsets that use outside-in tracking, requiring to place two base stations in your room. But therefore they support additional features shown in the VR introduction movie: it is easy to use the controller as a 3D mouse when working in 2D, YASARA can automatically blend in your mouse and keyboard when you look at them, and you can beam your chair into the virtual world by attaching a tracker to it.

Since some headsets are already in short supply, we collected the remaining purchase possibilities below. This page is updated frequently, you may have to press the reload button.

Vive Pro (Eye)

This is the currently best choice.

Europe:
869 EUR at Vive Store: https://www.vive.com/eu/product/vive-pro-full-kit/, you need to fine-tune your location at the bottom (e.g. Germany).
943 EUR at Jacob (1 headsets left): https://direkt.jacob.de/produkte/htc-vive-pro-99hanw003-00-artnr-4330633.html
1149 EUR at Proshop (4 headsets left) with shipping to Austria, Denmark, Finland, Germany, Norway, Poland, Sweden.

South East Asia:

Various contact addresses: https://www.vive.com/sea/storelocations/

e.g. Singapore: https://shop.beyondgeek.sg/collections/vive-1/products/vive-pro-eye

Worldwide shipping:
661 EUR (2 used headsets!) at Amazon Europe: https://www.amazon.de/dp/B07D9T6H1F (you can ship to all countries and pay around 90 EUR for Amazon Global Shipping)
1245 EUR at Macromart UK:
https://www.macromart.co.uk/collections/vive-pro-series/products/htc-vive-pro-2018
https://www.macromart.co.uk/collections/vive-pro-series/products/htc-vive-pro-mclaren-limited-edition

Note: When using Windows 10, we needed to connect it to a USB-2 port, with a blue USB-3 port the camera was slow and jerky. Windows 11 worked fine.

Valve Index

This is the second best choice, due to these disadvantages:

  • The cameras are too far apart, yielding a somewhat strange pass-through 3D view for more distant objects.
  • The cameras are jerky in Linux (but fine in Windows).
  • The controllers are made for video games with a focus on tracking individual fingers, which is not used by YASARA. We prefer the normal controllers of the Vive headsets. But you can buy these extra and use them with the Index.

Worldwide shipping:
1079 EUR at https://store.steampowered.com/sub/354231/

In case you don't like the controllers, you can replace them and even save money by ordering the headset plus two base stations only:

United States: https://www.vive.com/us/accessory/controller2018/

Europe: https://www.vive.com/de/accessory/controller2018/

Vive Pro 2

This is the third best choice, due to these disadvantages:

  • The Vive Pro 2 is at least 400 EUR more expensive than the Vive Pro, mostly due to the much higher LCD resolution (2448×2448 pixels per eye, while the Vive Pro has 1440×1600 pixels). However, YASARA does currently not make use of the extra resolution, since it slows rendering down too much, so it will look the same as the Vive Pro.
  • The Vive Pro 2 has a smaller vertical field of view than the other headsets, and we think that it produces somewhat stronger god rays (rays emanating from bright text on dark background), all together we find that the Vive Pro and the Valve Index give a better view.
  • The Vive Pro 2 works only in Windows, while the Vive Pro also supports Linux.

Worldwide shipping:
1499 EUR at https://www.vive.com

Europe:
1349 EUR at Galaxus: https://www.galaxus.at/de/s1/product/htc-vive-pro-2-vr-brille-16226044


Note:When using Windows 10, we needed to connect it to a USB-2 port, with a blue USB-3 port the camera was slow and jerky. Windows 11 worked fine.

Vive Cosmos Elite

This is the fourth best choice, due to these disadvantages:

  • YASARA cannot access the camera to show your keyboard and mouse in 3D when you look at them. You can only activate complete pass-through with a button on the side.
  • It does not support Linux
  • It uses the 1st generation base stations, which are limited to one single pair covering a 4×4 m VR area. The Vive Pro and Index use the second generation, which allows to place e.g. three stations in a triangle for better tracking in a larger area.

Europe:

649 EUR at Vive store: https://www.vive.com/de/product/vive-cosmos-elite/overview/

Meta Quest 2

This is the fifth best choice for 449 EUR, due to these disadvantages:

  • YASARA cannot access the camera to show your keyboard and mouse in 3D when you look at them. You can only activate complete pass-through by tapping twice on the side.
  • You cannot beam your chair to VR by attaching a tracker to it.
  • To us, it looks like the built-in games are fine, but everything streamed with SteamVR via cable or WiFi lags somewhat behind. This is especially noticeable if you display the built-in Quest menu on top of the scene. In Windows it's tolerable, but in Linux the lag is even stronger, so that sensible Linux users may end up with motion sickness.
This headset is current, you can buy it anywhere.

Pico 4

This is the last choice, which you should not buy for YASARA, only try it if you already own it. It has the same disadvantages as the Meta Quest 2 above, but in addition the lag in Windows is even stronger, so that motion sickness is easily possible, depending on your level of tolerance.






Supported VR headsets
Figure 1: These are the VR headsets we bought and tested extensively in Linux and Windows. They are thus officially supported, other headsets may work with limitations or not at all.