Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

YASARA related links

If you are working with YASARA yourself and have a website to show, please add it here.

CMBI course by Joules KerssemakersCMBI - The Center for Molecular and Biomolecular Informatics at the Radboud University Nijmegen, the Netherlands, is our main academic partner. It hosts the YASARA download servers and makes extensive use of YASARA for research and teaching (image on the right courtesy of Bart van Dieken), often combined in the Twinset with the CMBI's inhouse software WHAT IF.

Bio-Prodict - Developer of 3DM, a tool that can automatically generate super-family specific databases designed to guide scientific research in the field of protein engineering, drug design and DNA-diagnostics, and employs YASARA as an interactive database interface.

Spronk NMR Consultancy - A company that makes heavy use of YASARA for NMR related scientific development and consulting services.

Spronk Studio - A company that makes heavy use of YASARA to create scientific animations, just watch the videos below.

FoldX plugin - A YASARA interface to FoldX free energy predictions by Joost van Durme.

DRESS - A subset of the NMR structures deposited in the PDB, consistently refined in explicit solvent to obtain more realisitic results. Uses YASARA for structure conversions.

QUEEN - Working with NMR spectroscopy? Want to identify important NOEs and those that may have been misassigned? Then visit the QUEEN.

MCSIS - Molecular Class Specific Information System.

Click here to add your own site.

Videos related to YASARA

The following videos feature YASARA, were created with YASARA, or with the help of YASARA (combined with other 3D animation software):

Scientific animation: protein production and folding by Spronk Studio
How to study the impact of entropy on enzyme catalysis by Kürten and Syren, KTH Royal Institute of Technology
WeNMR Small Angle X-ray Scattering by Spronk Studio
Bio-NMR information campaign on structural biology by Spronk Studio
Asper Biotech - Arrayed Primer Extension technology by Spronk Studio
Science at the CMBI by Spronk Studio


Click here to add your own site.