Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

A touchable YASARA for Windows 8

When Windows 8 with its new touch interface arrived in 2012, it had a variety of innovative devices in tow, that has been growing steadily. By now, it appears that almost every thinkable way of building a computer around a touchscreen has been tried. Many of these devices have been optimized for mobility and thus contain power efficient but low-performing ingredients like Intel's Atom CPU and ImgTec's PowerVR GPU. Fortunately, YASARA has always been optimized to squeeze the highest performance out of any hardware, so this is not a show-stopper at all.

Watch the video on the right, which shows YASARA running on the Atom/ PowerVR based Samsung ATIV Smart PC, including interactive molecular dynamics simulations and docking. The video also gives detailed YASARA usage instructions for Windows 8 touch screens.

If you plan to buy a Windows 8 gadget, check Amazon's customer feedback section first. Since most devices are brand new, you may still encounter a few teething problems, which break the rule that paying more money gives you better hardware.

Here are a few examples:
Acer Iconia W510
Asus Vivo Tab
Microsoft Surface Pro
Samsung ATIV Smart PC

Samsung SmartPC 500T
The image above shows Samsung's ATIV Smart PC 500T running YASARA. The screen is actually a tablet that can be detached from the keyboard. Watch the video below for more details.

This demo video shows you how to get in touch with YASARA on Windows 8 tablets. It demonstrates YASARA's touch user interface, molecular graphics, interactive molecular dynamics simulations, and finally some docking with VINA.