Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

The YAMBER force field

2A0B CrystalYAMBER is a second generation self-parametrizing force field. It has been derived from the AMBER force field (hence the name Yet Another Model Building and Energy Refinement force field) by an optimization procedure first described for the NOVA force field. This time, the optimization targets were however complete unit cells of high resolution X-ray structures. YAMBER is the most accurate protein MDforce field YASARA has to offer. A YASARA movie about YAMBER is also available for download.

A paper describing YAMBER was published in:

Making optimal use of empirical energy functions: Force-field parameterization in crystal space.

Krieger E, Darden T, Nabuurs SB, Finkelstein A, Vriend G.
Proteins. (2004) 57:678-683

If you enter your email address below, you will receive the YAMBER parameters and a reprint of the YAMBER paper. The successor of YAMBER (the YASARA force field) has been released in 2008 as part of YASARA Structure.


YAMBER force field parameter request

Notify me when the successor to YAMBER becomes available.
The email address will not be used for any other purpose than indicated here.