Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

Choose your YASARA stage

There are four different stages of YASARA for Linux, Windows and MacOS, aimed at increasingly complicated fields of application. A certain stage contains the features of all the previous stages, plus a number of additional functions to tackle a wider range of scientific questions.


Stage I: YASARA View - Free download
 

YASARA View is available for free and contains the basic functions you need to explore a macromolecular structure interactively, comparable to other molecule viewers. As a bonus, you get YASARA's innovative Vulkan 3D engine, which allows to visualize gigastructures with billions of atoms, you can load multiple structures at the same time, create publication-quality ray-traced images including labels, and program your own macros and Python plugins. Included is YASARA Movie, a player for multimedia presentations and tutorials created with any of the higher stages.

Download for free now. Show all the details.


Stage II: YASARA Model
 
YASARA Model

YASARA Model contains YASARA View and adds all the functions you need to explore, analyze and model small and macromolecules in a production environment. This includes many features you often miss: unlimited undo/redo, macro recorder, productive virtual reality with common headsets, quad-buffered stereo with shutter glasses. You can load an unlimited number of structures at the same time, move them around independently and create multimedia presentations (YASARA Movies). These movies can be played back with all stages of YASARA, including the free YASARA View.
YASARA Model is free for academic use and costs 600 € / 690 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, MacOS costs 20% extra, shipping is included, customers in Austria have to add 20% VAT.

Download the free academic license, place a commercial order, or get a quote. Show all the details.


Stage III: YASARA Dynamics
 
YASARA Dynamics

YASARA Dynamics contains YASARA Model and adds support for molecular simulations. Beside the YASARA NOVA Force Field and the new highly accurate YAMBER force fields, you can use other well known MD force fields like AMBER, and run accurate all-atom MD simulations in aqueous solution with Particle Mesh Ewald longrange electrostatics. YASARA Dynamics is not a "black box" with input and output files, but shows the MD simulation in real-time on screen. You can fully interact with the scene, pull atoms or whole molecules around and finally do the type of molecular modeling that Cyrus Levinthal already pioneered back in 1966 ("..do the same type of pulling and pushing in the computer that we can do with our hands while building actual models. ", cited from an article in Scientific American).
YASARA Dynamics costs 300 € / 345 $ for academic and 2400 € / 2760 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, MacOS costs 20% extra, shipping is included, customers in Austria have to add 20% VAT.

Place an order or get a quote. Show all the details.


Stage IV: YASARA Structure
 
YASARA Structure

YASARA Structure contains YASARA Dynamics and adds all the functions needed to predict and validate macromolecular structures, including ligand docking and highly accurate force fields with knowledge-based potentials, and an optional module for NMR structure determination.
YASARA Structure costs 410 € / 471 $ for academic and 3600 € / 4140 $ for commercial use, including one year of support and updates. This price includes Windows and Linux, MacOS costs 20% extra, shipping is included, customers in Austria have to add 20% VAT.

Place an order or get a quote. Show all the details.