Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Choose your YASARA stage

There are four different stages of YASARA for Linux, Windows and Mac OS X, aimed at increasingly complicated fields of application. A certain stage contains the features of all the previous stages, plus a number of additional functions to tackle a wider range of scientific questions.


Stage I: YASARA View - Free download
 

YASARA View is available for free and contains the basic functions you need to explore a macromolecular structure interactively, comparable to other molecule viewers. As a bonus, you get YASARA's innovative 3D engine, which is up to 35 times faster than what you usually know from OpenGL (see benchmarks), you can load multiple structures at the same time, create publication-quality ray-traced images including labels, and program your own macros and Python plugins. Included is YASARA Movie, a player for multimedia presentations and tutorials created with any of the higher stages.
Click here to download, click here for more details.


Stage II: YASARA Model
 
YASARA Model

YASARA Model contains YASARA View and adds all the functions you need to explore, analyze and model small and macromolecules in a production environment. This includes many features you often miss: unlimited undo/redo, macro recorder, quad-buffered stereo with shutter glasses or the DTI virtual window. You can load up to 100 structures at the same time, move them around independently and create multimedia presentations (YASARA Movies). These movies can be played back with all stages of YASARA, including the free YASARA View.
YASARA Model costs 110 € / 126 $ for academic and 550 € / 632 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, Mac OS X costs 20% extra, shipping is included, customers in Austria have to add 20% VAT.

Click here to order or get a quotation, click here for more details,


Stage III: YASARA Dynamics
 
YASARA Dynamics

YASARA Dynamics contains YASARA Model and adds support for molecular simulations. Beside the YASARA NOVA Force Field and the new highly accurate YAMBER force fields, you can use other well known MD force fields like AMBER, and run accurate all-atom MD simulations in aqueous solution with Particle Mesh Ewald longrange electrostatics. YASARA Dynamics is not a "black box" with input and output files, but shows the MD simulation in real-time on screen. You can fully interact with the scene, pull atoms or whole molecules around and finally do the type of molecular modeling that Cyrus Levinthal already pioneered back in 1966 ("..do the same type of pulling and pushing in the computer that we can do with our hands while building actual models. ", cited from an article in Scientific American ).
YASARA Dynamics costs 275 € / 316 $ for academic and 2200 € / 2530 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, Mac OS X costs 20% extra, shipping is included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, click here for more details.


Stage IV: YASARA Structure
 
YASARA Structure

YASARA Structure contains YASARA Dynamics and adds all the functions needed to predict and validate macromolecular structures, including ligand docking and highly accurate force fields with knowledge-based potentials, and an optional module for NMR structure determination.
YASARA Structure costs 375 € / 431 $ for academic and 3300 € / 3795 $ for commercial use, including one year of support and updates. This price includes Windows and Linux, Mac OS X costs 20% extra, shipping is included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, click here for more details.