Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA for Android



Time is always short in science, and consequently a major focus during YASARA development has been to deliver your results as quickly as possible. This goal could be achieved by using PVL, YASARA's custom vector language, that employs MMX/SSE/AVX assembler code to deliver a 2×-4× performance  advantage over normal C/C++ applications. In 2012, it has finally become possible to carry this performance advantage along to a different world - the world of Android smartphones and tablets. The credit goes to Intel, who released the Medfield 'system on a chip' (in-depth review available here), that empowers smartphones and tablets to execute not only traditional Android apps, but also YASARA's highly optimized SSE assembler code.

Medfield and its built-in PowerVR GPU are even fast enough to run YASARA 'as it is', so you do not get a stripped down app that just shares its name with the desktop version. Rather, everything works exactly as you know and expect it, making YASARA the most feature-complete molecular modeling software for smartphones and tablets. Watch the video on the right to see how we tuned the user interface to guarantee an enjoyable experience also on tiny smartphone screens.

YASARA for Android was released in April 2013, and requires an Intel-inside smartphone or tablet. If you own an iPhone/iPad, please look here for details. If you are just about to buy yourself a new gadget, consider to choose one from the list below, and verify that it has an Intel Atom CPU before you buy. There is no extra charge for YASARA on Android. An very large list of

Intel-inside Android smartphones that can run YASARA:

  • Any smartphone with Intel Atom CPU and a screen resolution >=480×640 pixels can run YASARA. Since Intel unfortunately left the smartphone market in 2017, the number of available smartphone models is declining, and your best option is to search for the words 'smartphone' 'intel' 'atom' on Amazon or E-Bay.
  • Asus ZenFone 2 ZE551ML : One of the last available Intel smartphones in 2017, powered by an Intel Atom Z3580 CPU with 4 cores, with nice FullHD screen, the currently recommended smartphone for running YASARA. Prices start at 150 EUR.
  • ASUS Zenfone 6 : powered by an Intel Atom Z2580 CPU with 2 cores.
  • Lenovo K900 : another smartphone powered by the fastest Intel Atom Z2580 CPU, unfortunately the full HD screen slows down the graphics, and it is not widely available.
  • Motorola Razr i (see video on the upper right): This was the first smartphone that could run YASARA, but in the mean time the hardware is outdated, making it a low-budget option priced at ~200 EUR. Be careful not to order the 'Motorola Razr', which is a normal ARM- based phone and cannot run YASARA.
  • A regularly updated list of other smartphones that can run YASARA is provided by Intel, e.g. the Acer Liquid C1* (Asia), Lava Xolo X900 (India), Lenovo K800 (China), MegaFon Mint (Russia), Motorola MT788 (China), Orange San Diego (France, UK), ZTE Grand X In (Europe).

Intel-inside Android tablets that can run YASARA:

  • Any tablet with Intel Atom CPU and a screen resolution >=640×480 pixels can run YASARA. Since the available models change frequently, a good approach is to search for the words 'tablet' 'android' 'intel' 'atom' on Amazon or E-Bay and pick the one that best suits your needs (try to get at least 4 CPU cores if you want to run simulations). An up2date list sorted by price can also be found at this German price comparison site.
  • ASUS Transformer Pad TF103C (Atom Z3745): With optional keyboard, currently the best Android tablet to run YASARA (see image at the bottom right).
  • Lenovo Yoga 2 (Atom Z3745)
  • Lenovo Tab S8-50 (Atom Z3745)
  • Acer Iconia Tab 8 (Atom Z3745)
  • Acer Iconia One 7/8 (Atom Z3735)
  • Blaupunkt Polaris IC (Atom Z3735)
  • ASUS Fonepad 8 (Atom Z3560)
  • ASUS Fonepad 7 (Atom Z3530)
  • Samsung Galaxy Tab 3 10.1
  • Asus MeMO Pad FHD 10
  • Ramos W32: First tablet that could run YASARA (see video on the lower right), but technically obsolete now.
The following limitations currently apply to YASARA for Android:

The video above shows YASARA running on the Motorola Razr i smartphone, including a molecular dynamics simulation with explicit solvent. It also gives some general background information about YASARA on Android. Detailed usage instructions can be found in the second video further below.

Lava Xolo X900
The Lava Xolo X900, available in India.
Motorola Razr i
The Motorola Razr i, distributed worldwide
Space

Orange San Diego
The Orange San Diego,  available in France and the UK.
ZTE Grand X In
The ZTE Grand X In, distributed worldwide.
The video above shows YASARA running on the Ramos W32 tablet, providing general YASARA usage instructions  and an example for coloring protein surfaces by electrostatic potential using a Poisson-Boltzmann calculation. Everything works exactly the same on smartphones. Many thanks to Steven Martin for guiding through the movies.
ASUS Transformer Pad TF103C
The tablet above is the ASUS Transformer Pad TF103C, one of the currently best tablets to run YASARA on Android. The price of 250 EUR includes the keyboard dock.