Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

The YASARA Virtual Reality Workstation on Android

Since April 2018, we are happy to offer our customers inside the European Union the YASARA Virtual Reality Workstation including mouse and keyboard for 175 EUR. Note that you additionally need a license of YASARA Dynamics or Structure. To celebrate the five year anniversary and the release of YASARA VR for PCs, we are currently preparing a new 2023 release that will work with your own Android smartphone free of charge.

The YASARA VR workstation is based on YASARA for Android. It combines the following items:

  1. Asus Zenfone 2 with four Intel Atom Z3580 CPU cores @ 2.3 GHz, 4 GB RAM and 32 GB flash, used for a few days, but free of scratches or other damage (75 EUR)
  2. Celexon VRG-1 headset, 10 EUR
  3. Bongem Rechargable Bluetooth Mouse, 15 EUR
  4. Arteck Stainless Steel Universal Portable Wireless Bluetooth Keyboard, 30 EUR
  5. Installation, testing, packaging and shipping, 45 EUR

The VR workstation runs a fully functional YASARA Dynamics, with the user interface and all functions right as you know them from your PC.

To order the VR workstation for 175 EUR in the EU (+20% VAT for orders from Austria or without VAT number), just copy/paste the following information and send it to :

My YASARA serial number:
My favorite keyboard layout: US / UK / German
My shipping address if different from last invoice:

If you are located outside the European Union, please contact us to negotiate shipping. Detailed instructions about the hardware and the installation are available.


The following limitations currently apply to the YASARA VR workstation:
  • If you are not used to typing blindly on a keyboard, you can still use e.g. the function keys to change the scene style, but you have to resort to the slower on-screen keyboard for typing text (i.e. to specify a PDB ID to load, you need to click letters with the mouse pointer).
  • There is no 'asynchronous time warp'. This means that if the frame rate drops below 60 Hz, the VR experience becomes less optimal, and if it drops below 30 Hz,  there can be 'motion sickness'. YASARA therefore offers a feature to automatically disable head-tracking if the frame rate gets too low, turning the VR workstation into a 3D workstation. In practice, an interactive MD simulation of hot air can still be done fast enough for VR, while an interactive MD simulation of a protein in water with PME takes longer and should be done without head-tracking.
  • Only YASARA Dynamics is available for Android, so you cannot use YASARA Structure features in the VR workstation, even if you have a YASARA Structure license.
  • There are no Python plugins.
  • Ray-tracing with POV-Ray is not possible, since there is no POV-Ray for Android. But you can save POV-Ray scenes.

The video above introduces the YASARA Virtual Reality Workstation and shows a few things you can do with it.
Space
VR-Workstation
Picture of the YASARA Virtual Reality Workstation package for 175 EUR: Headset with Asus Zenfone 2, keyboard and mouse.