Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Contribute movies, macros, plugins or source code

If you developed an exciting movie, helpful macro or snaky Python plugin, we strongly encourage you to submit it to the YASARA repository. Of course you keep the full copyright of your development, nevertheless we pay you for the permission to publish your work online (licensed under the GNU GPL). You can expect about 30 Eurocents per line of Yanaconda code, 20 Eurocents per line of Python code, and 1 EUR per image. So if you own an academic license of YASARA Dynamics, you can get a free one year extension by contributing just 300 lines of code.

If you developed a smart algorithm in the field of molecular modeling and want to make it easily available to others as part of YASARA, your maximum reward is a life-long YASARA license. A reference to your work will be added to the page with citation instructions to make sure that everyone using your work cites it properly. Just enter a description below, but do not upload any files yet. We will get back to you.

The following restrictions apply:

  • The credits you earn can only be used to pay YARARA license fees, we cannot send you any money back.
  • Blank lines do not count, comment lines count half.
  • Depending on the size and usability of your contribution, further negotiation may be required.


Make a contribution

Type of your work:
Description of your work:
ZIP file with your contribution:
Even if your contribution consists of just one macro file, please ZIP it.
The email address must be the same as in your initial YASARA registration.
Click here to change it.