Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

YASARA Credit Card Payment


YASARA payment by credit card is done in three steps:

  • Click the 'Pay Now' button below after you finished reading these instructions.
  • Fill in the invoice number and the amount to pay, click 'Update Totals' and 'Continue' as shown in the example at the bottom of this page.
  • Finally click 'Pay with debit or credit card' and enter your credit card data, which will be securely processed by PayPal. If you only get an option to open a PayPal account, please clear your browser cache and history or use a different browser/computer. If you get an error message please scroll down to the bottom of this page.


Click below to start



Credit card payment instructions
Hints for errors:
  • If you get the message that "the card you entered cannot be used for this payment", this can mean that the card is already associated with another PayPal account and you should use this other account to pay directly.
  • If you get the message "We're sorry, we're unable to process your payment at this time", then please try again later as indicated. One user had success by telling PayPal to use the bank account instead of the credit card.