Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Website Cross-Linking

No matter if you are working with YASARA yourself or are maintaining a web directory, you are welcome to link to our site. In exchange, we will place a link to your own site on our homepage at a comparable location (e.g. if you place your link at the front page, we will do the same). Below you find a number of suggested link options, right click on the image to save it.

Link to www.YASARA.org

HTML Code:
<a href= "http://www.yasara.org"><img src="link_yasara.gif" title="Click here to go to www.YASARA.org" alt= "Link to www.YASARA.org" width=128 height=105></a><br>
Link to www.yasara.org

HTML Code:
<a href= "http://www.yasara.org"><img src="link_twinset.gif" title="Click here to go to www.YASARA.org" alt= "Link to www.YASARA.org" width=128 height=125></a><br>
YASARA - Molecular graphics, modeling and simulations, optimized for highest speed and accuracy. Free download from www.YASARA.org.
HTML Code:
<a href="http://www.yasara.org">YASARA</a> - Molecular graphics, modeling and simulations, optimized for highest speed and accuracy. Free download from <a href="http://www.yasara.org">www.YASARA.org</a>.



Information about your site

Internet HTTP address:
Description of your site:
(if you want with HTML code)
Optional link to a GIF image: