Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

Cut-planes in YASARA


In YASARA you can easily create cut-planes, that clip part of an object away and let you look inside. The most prominent application is to cut surfaces open, as shown in figure 1.

Cut-planes can be rotated and shifted interactively, and you can combine multiple cut-planes to create convex, as well as concave clipping objects. The movie in figure 2 shows a few of the possibilities.





Cut plane

Figure 1: A cut-plane object used to clip half of a molecular surface away and show the protein.


Figure 2: Screen recording of YASARA's interactive cut-plane tutorial. A higher quality version can be watched at YouTube, click on 'Watch in high quality' below the video. Since YASARA creates these animations in real-time using OpenGL, simply download the corresponding macro (GNU GPL licensed) from the YASARA movie page to watch it in highest resolution with up to 60 frames per second. Background created by Sven Geier.