Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Administrate group leader license

The YASARA group leader license allows you to register a second email address for updates and support (in addition to the group leader's address). This second account can be configured here.

  • When you request an update by serial number (or by clicking on Help > Request update), it depends on the settings below who receives the update.

  • When you request an update by email address, make sure to input your current YASARA version as well. (If updates are requested for the group leader's and the second email address, it may become unpredictable which YASARA version is actually installed).


Configure secondary YASARA account

Your serial number:
Your serial number is displayed on YASARA's startup screen and in the Help>About menu.
Your first name:
(Must match the group leader's domain)
Send updates by default to: