Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA for iPhone and iPad

There are currently three main obstacles that prevent a YASARA release for iOS:

  • To squeeze the most out of your smartphone or tablet (like interactive molecular dynamics simulations),  optimized assembler code is required. We have this code for Intel/AMD CPUs, but not for iOS ARM CPUs, and this market is too small to make porting the code financially feasible. Selected Android smartphones and tablets with Intel CPU can however execute our code directly, which made YASARA for Android straightforward.  So YASARA for iOS is on hold until Apple switches from ARM to Intel CPUs (just like they did in 2006 when they abandoned PowerPC CPUs).
  • Apple does currently not allow their iPhone/iPad users to install any software they want, but limits them to the App store. Unfortunately only the free YASARA View can be distributed this way easily, since the higher YASARA stages require a license fee to fund development. Our users pay this fee for the Linux/ MacOS/ Windows version of YASARA, and get the Android version as a free extra. But Apple does not permit the distribution of free extras. Since Apple also insists that all business is done via the App store, we would effectively have to offer YASARA there at 1.43 times the normal price (since Apple keeps 30% of the sale, and 70% of 143% is 100%, the original price).
  • Apple makes it very difficult to develop for iOS on other platforms than MacOS. But for efficiency, all our development work is done in Linux.  Google supports all major operating systems as Android development platform.

As a summary, we currently suggest our users to go for Android. There is a much larger number of devices to choose from, the price/performance ratio is significantly better, and you get much more freedom. And if you like YASARA, pick a device with Intel CPU.

The video above shows YASARA running on the Motorola Razr i smartphone, including a molecular dynamics simulation with explicit solvent. It also gives some general background information about YASARA on Android. Detailed usage instructions can be found in the second video further below.
Space
The video above shows YASARA running on the Ramos W32 tablet, providing general YASARA usage instructions  and an example for coloring protein surfaces by electrostatic potential using a Poisson-Boltzmann calculation. Everything works exactly the same on smartphones. Many thanks to Steven Martin for guiding through the movies.
Ramos W32 Android tablet
The tablet above is the Ramos W32, the world's first Intel-inside tablet, no longer on sale.