Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


License Agreement

  • Models@Home comes free of charge. Since it is not part of our YASARA molecular modeling software, please don't expect a comparable level of support. In exchange, the source code is available, so that you can fix any problems yourself.

  • Models@Home is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY, without even the implied warranty of merchantability or fitness for a particular purpose. The copyright holders and/or other parties provide the data "AS IS", without warranty of any kind, either expressed or implied. The entire risk as to the quality and performance of the data is with you. Should any data prove defective, you assume the cost of all necessary servicing, repair or correction.

  • Any description of work in which Models@Home was/is involved (scientific papers, websites etc.), should cite:
    "Models@Home: distributed computing in bioinformatics using a screensaver based approach", E.Krieger & G.Vriend (2002) Bioinformatics 18, 315-318 and contain the following text:
    "Models@Home is freely available from www.yasara.org/models" with the URL hyperlinked.

  • The Models@Home, CMBI, WHAT IF and YASARA logos in the screen saver must not be removed or replaced. (But feel free to add your own logos.)

I agree | I disagree