Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

Products

There are four different stages of YASARA for Linux, Windows, MacOS and Android, aimed at increasingly complicated fields of application. A certain stage contains the features of all the previous stages, plus a number of additional functions to tackle a wider range of scientific questions. Features with unique properties which you will not find in other programs are marked with orange buckyballs below.

YASARA View - Molecular graphics, modeling and analysis, freely download now.

YASARA Model - Everything above, plus advanced molecular modeling

YASARA Dynamics - Everything above, plus molecular simulations

YASARA Structure - Everything above, plus structure prediction and validation, docking, knowledge-based potentials

YASARA Virtual Reality Workstation - Molecular modeling and simulation in 3D with head-tracking

YASARA NMR Module - NMR structure determination from your restraints

YASARA/WHAT IF Twinset - Extensive structure validation (PDBReports) and WHAT IF functions

Bio-Prodict 3DM - The protein superfamily data integration platform

Android tablets and smartphones that can run interactive MD simulations starting at 175 EUR.

A stereoscopic molecular modeling lab for 250 EUR, and a FullHD/4K 3D cinema for 1200 EUR.

Read more about the philosophy behind YASARA.

System requirements: None, please download the free YASARA View to verify that YASARA runs on your computer (and please contact us if you encounter problems). Hints for high molecular dynamics performance are available.

Stage I: YASARA View - Free download
 

YASARA View is available for free and contains all the functions you need to explore a macromolecular structure interactively. As a bonus, you get YASARA's innovative 3D engine, which is up to 10 times faster than what you usually know from Vulkan and OpenGL, you can load thousands of structures at the same time, move them around independently, create publication-quality ray-traced images including labels, and program your own macros and Python plugins. Included is YASARA Movie, a player for multimedia presentations and tutorials created with any of the higher stages, as well as the YASARA Python module to simply 'import yasara' in your Python scripts.

Key features:


Download for free now. Show screenshots, or the complete feature list.


Stage II: YASARA Model
 
YASARA Model

YASARA Model contains YASARA View and adds all the functions you need to explore, analyze and model small to macromolecules in a production environment. This includes many features you often miss: unlimited undo/redo, macro recorder, virtual reality, quad-buffered OpenGL stereo with shutter glasses or stereoscopic screens. You can create multimedia presentations (YASARA Movies), which can be encoded as MPEGs and pasted into Powerpoint or played back with all stages of YASARA, including the free YASARA View.

Key features:

YASARA Model USB stick
YASARA Model is free for academic users and costs 600 € / 690 $ for commercial single users, including one year of support and updates. The commercial price includes Windows, Linux and Android, MacOS may cost extra, a license for the entire research group costs 100% extra. Delivery is via download link. Customers in Austria and customers without VAT-number in the EU have to add 20% VAT.

Download the free academic license, place a commercial order, or get a quote. Show screenshots, the complete feature list, or the license details.

Stage III: YASARA Dynamics
 
YASARA Dynamics

YASARA Dynamics contains YASARA Model and adds support for molecular simulations. In addition to YASARA's own force fields (NOVA, YAMBER) you can use other well known MD force fields like AMBER, and run accurate all-atom MD simulations in aqueous solution with Particle Mesh Ewald longrange electrostatics. YASARA Dynamics is not a "black box" with input and output files, but shows the MD simulation in real-time on screen. You can fully interact with the scene, pull atoms or whole molecules around and finally do the type of molecular modeling that Cyrus Levinthal already pioneered back in 1966 ("..do the same type of pulling and pushing in the computer that we can do with our hands while building actual models. ", cited from an article in Scientific American).

Key features:

YASARA Dynamics USB stick YASARA Dynamics costs 300 € / 345 $ for academic and 2400 € / 2760 $ for commercial single users, including one year of support and updates. This price includes Windows, Linux and Android, MacOS may cost extra, a license for the entire research group costs 100% extra. Delivery is via download link. Customers in Austria and customers without VAT-number in the EU have to add 20% VAT.

Place an order or get a quote. Show screenshots, the complete feature list, or the license details.

Stage IV: YASARA Structure
 
YASARA Structure

YASARA Structure contains YASARA Dynamics and adds all the functions needed to predict and validate macromolecular structures, including ligand docking and highly accurate force fields with knowledge-based potentials. If you already own one of the other YASARA stages, you can upgrade easily, just contact us for a quote.

Key features:

YASARA Structure USB stick YASARA Structure costs 410 € / 471 $ for academic and 3600 € / 4140 $ for commercial single users, including one year of support and updates. This price includes Windows and Linux, MacOS may cost extra, a license for the entire research group costs 100% extra. Delivery is via download link. Customers in Austria and customers without VAT-number in the EU have to add 20% VAT.

Place an order or get a quote. Show screenshots, the complete feature list, the license details, or the hardware recommendations for MD.

YASARA Virtual Reality Workstation for 175 EUR
 

The YASARA Virtual Reality Workstation is the most complete virtual reality solution for molecular modeling and simulation. For just 175 EUR, you get the complete hardware with 4 Intel CPU cores @ 2.3 GHz, headset, mouse and keyboard, to do interactive molecular modeling and MD in 3D with head-tracking anywhere on the planet.

YASARA VR Workstation An introductory video, all the details and order information can be found here. This offer is limited to owners of a YASARA Dynamics or YASARA Structure license.

YASARA NMR Module
 

The YASARA NMR Module solves protein structures at the touch of a button, based on the protein sequence and distance-, dihedral-angle and RDC restraints. Input files are compatible with X-PLOR, folding and refinement are visualized in real-time on screen, allowing to identify problematic restraints. Floating assignments and non-standard residues are supported, all the details are described here.

YASARA NMR Module The YASARA NMR Module is an add-on for YASARA Structure and costs 60 € / 69 $ for academic and 600 € / 690 $ for commercial use, including one year of support and updates. This price includes Windows and Linux, MacOS costs may cost extra. Customers in Austria and customers without VAT-number in the EU have to add 20% VAT. If you do not have YASARA Structure yet, click here to order or get a quotation and click here for license details, otherwise contact us directly.

3DM - the protein superfamily data integration platform
 

The Bio-Prodict 3DM information systems are protein super-family platforms that collect, combine and integrate many different types of protein-related data. 3DM systems are designed to facilitate the exploration of sequence-structure-function relations, and have successfully been used many times to elucidate the function of individual amino acids, predict the effects of mutations, among others.

3DM features The 3DM platform is developed and distributed by Bio-Prodict, a CMBI spin-off company like YASARA Biosciences. Please contact Email for details and pricing information. An introductory movie can be watched at the Bio-Prodict site, more details about YASARA integration are available here.


The WHAT IF / YASARA Twinset
 
Twinset

The Twinset is a customized joint-distribution of WHAT IF and YASARA Dynamics or YASARA Structure (currently Linux and Windows only). With over 3500 citations, WHAT IF is a widely used program for structure validation and modeling. In the Twinset, WHAT IF inherits YASARA's user interface, graphics engine, macro language, unlimited undo/redo etc, so that WHAT IF functions become easily accessible.

The Twinset is freely available, but you need licenses for YASARA Dynamics or YASARA Structure and also WHAT IF. Click here for WHAT IF license details, and note that WHAT IF is now shareware/donationware. Customers in Austria have to add 20% VAT.

To order the Twinset, just place a normal order for YASARA Dynamics or YASARA Structure and then request the Twinset upgrade from support. If you already own YASARA, email us your YASARA serial number.


The FullHD/4K 3D cinema for 1200 EUR
 
3D Molecular modeling cave

During the past years specialized 3D beamers, that previously cost above 10000 EUR, have finally become mainstream technology. You can now easily build your private molecular modeling showroom, projecting giant 3D views that measure several meters along the diagonal. The image on the right shows the 3D beamer Optoma UHD40, costing around 1200 EUR. The beamer projects the images for left and right eye alternatingly with 120 Hz. So you additionally need shutter glasses to separate the images, and they must support the DLP-link signal sent by the beamer. There are countless glasses available, prices start at 20 EUR, inside the EU we can recommend the Pulox glasses. The amazing thing about the Optoma UHD40 is that is not only supports FullHD resolution in 3D, but also 4K in 2D mode.
Notes: The beamer has been tested in Linux and Windows. Especially in Linux the installation is non-trivial, but we prepared detailed instructions for all owners of YASARA Model+, please contact us. Your graphics card must support quad buffered OpenGL stereo, a feature which is normally only available in workstation products like nVIDIA Quadro and AMD FireGL. At least YASARA Model is required to display stereo. Other beamers reported to work by YASARA users: Optoma HT3800.


Molecular modeling on Android for 66 EUR
 
Android devices

Since April 2013, YASARA is available for selected Android smartphones and tablets, providing today's most feature-complete mobile molecular modeling environment, including interactive MD simulations. Tablet prices start at 66 EUR, two videos and all the details are available here.


The 3D molecular modeling lab for 250 EUR
 
3D Molecular modeling lab

Stereoscopic 3D molecular modeling hardware has become easily affordable, so that entire classrooms can enjoy this unique experience. The image on the right shows the easiest and cheapest solution: 3D vision is provided using 'passive stereo', where the images for left and right eye are shown in odd and even pixel lines and separated using flicker-free polarized glasses. The first popular screens with this feature were the Zalman ZM-M215W, ZM-M220W and ZM-M240W, costing around 200 EUR. Later follow up models included the LG D2342P, the HP 2311x, the AOC e2352Phz or the Viewsonic V3D231. Unfortunately all have been discontinued, so screening second hand sites like Ebay is currently the only option. The big advantage is that this type of display is directly supported by YASARA with any graphics card and any operating system (no expensive Quadro/FireGL cards or special video drivers are needed). You can move your molecules through 3D space using the Connexion 3D SpaceNavigator with six degrees of freedom. Order now for 50 EUR.
Notes: The ZM-M220W has a resolution of 1680×1050 pixels. The polarized glasses ensure that the left eye sees only the odd pixel lines, while the right eye sees the even lines. So the resolution is reduced to 1680×525 pixels per eye as soon as the glasses are put on. This is hardly noticeable when looking at molecules, but becomes apparent when looking at characters. Text is therefore harder to read than with alternative, more expensive stereo solutions. Without glasses, the screen behaves just like any other screen and can be used for everyday work. It has a quite glossy surface, reflections can be a problem in bright rooms, but are hardly noticeable in somewhat darker 'molecular modeling caves'. At least YASARA Model is required.


The 3D modeling showcase: a huge 3DTV for 380 EUR
 
LG 42LB620V

If you want to demonstrate 3D modeling on a large screen, we recommend passive 3DTVs like the LG 42LB620V shown on the right. With a diagonal of 42" (107 cm), two polarized 3D glasses and a price of 380 EUR, this 3DTV was an excellent deal, unfortunately it has been discontinued like most other passive 3DTVs. Fortunately large quantities were sold, so you can still find them on second hand sites like Ebay. Passive 3DTVs use exactly the same principle as described above for passive 3D computer screens, so they will work with any operating system and any graphics card, with YASARA running in window or fullscreen mode.
Notes: Make sure to buy a screen with a resolution of at least 1920×1080 pixels (FullHD). Since the images for left and right eye are shown in odd and even pixel lines, this leaves an effective resolution of 1920×540 pixels per eye, and you certainly do not want a lower resolution on such a large screen. It is essential that the 3DTV supports a display mode where the input signal is shown directly on screen, without scaling (overscan) and other post-processing (which would destroy the stereo effect). On LG 3DTVs, you can set this display mode by labeling the input with "PC" (push the "Settings" button on the remote, then go to Input > HDMI1, push the red button with the single white dot and select the "PC" label). If your graphics card/notebook only has a DVI output, don't forget to buy a DVI->HDMI adapter and a HDMI cable. Finally, it is noteworthy that passive stereo screens have a certain viewing volume. On the LG 42LB620V, your head should be located about 2 meters away, aligned with the bottom of the screen (i.e. you should be sitting or the screen should be hanging high up on the wall). Inside the viewing volume, the 3D effect is crystal clear, but outside, there can be considerable ghosting. At least YASARA Model is required, click Window > Stereo > Interlaced to enable stereo. If the stereo is 'inside out', click Window > Stereo > Swap left and right.


High resolution 3D modeling for 350 EUR
 
Viewsonic V3D241wm

High resolution 3D stereo with active shutter glasses is the next higher level, since it does not suffer from the reduced resolution of the passive screens above. The most popular system was nVIDIA's 3D Vision system, which has unfortunately been discontinued due to the rise of Virtual Reality, leaving again second hand sites like Ebay as the only supplier for 3D glasses and corresponding 3D-Vision ready screens.
Notes: Your graphics card must have a dual-link DVI connector and support quad buffered OpenGL stereo, a feature which is normally only available in workstation products like nVIDIA Quadro and AMD FireGL. At least YASARA Model is required.


The Models@Home cluster system
 
Twinset

Models@Home is a distributed computing environment that follows the spirit of the famous Seti@Home project, but is not tied to a specific application. Instead you can run all your favourite programs in parallel, without any need to modify or adapt them. The Models@Home screensaver allows to turn a heterogeneous Windows / Linux network into a uniform cluster.  At the CMBI, Models@Home is used for most protein modeling tasks, all YASARA force fields were developed with computer power provided by Models@Home. Models@Home is freely available including the source code.
Click here to download, click here for more information.