Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA Servers

This page provides access to a limited subset of YASARA functions via web servers hosted at the CMBI, so that published methods can be tried without having to purchase YASARA. Installing YASARA locally provides much more powerful means to boost your research.


YASARA Minimization Server

This server performs an energy minimization of your protein model with the YASARA force field as described in "Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8" (2009) Proteins 77 (Suppl. 9). Click here to access the server.



AutoSMILES Server

This server assigns force field parameters for organic molecules, usually proteins with bound ligands, using the AutoSMILES approach. Click here to access the server.



NOVA Server

The NOVA force field was described in "Increasing the precision of comparative models with YASARA NOVA - a self-parameterizing force field" (2002) Proteins 47,393-402. Over the past years, this force field has been replaced with the significantly more accurate YASARA force field. Simply use the server at the top of this page instead.